SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12501
Pre Gene Modal
BGIBMGA001503
Annotation
PREDICTED:_uncharacterized_protein_LOC105842132_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.735
 

Sequence

CDS
ATGGAGGCGGCGTGTCTCAAACGTATGGAGGATCTCAACCAAACCCATCGGAGAACCAGCAATAGTAGAATCCTTACCAAAAAACTCTGCGCCAGCAACAAACAATCTAGCACCAGAATAGGAATCTTACAAATTGAGAACATTTCATACCAGATTACAAACGACTACTCACAAATTGAAACGTTCTACCCATCTCTCAACTTTCTCTACGCCAATGTACGCAGCATTGTTAAGCCGGGAAAGTTTGATGAGCTCAAGTGCGTCCTGAAGTCTATCGATAAGGGTGTACACGTTGTTCTTCTCACCGAAACTTGGATCAAATCTGAAAATGATGCCATGAAACTACATTTGCCAAATTACACTCATCATTACAGCTATCGTAACGACATCAGAGGAGGCGGCGTGTCTATATACGTCCATAATAATATCAAACACAGCACGACTGAAGATAAATACAGCAATGGCAATAACTATCTTTGGGTGTATCTTGAGCAACATGGATTACACGTTGGAGTTGTATACAAGCCAGGAACCACAAATACAGAAGATTTTCTTATCGATTATGAACAGCAACTACATGACAGAAATCGAACCATTATTTTCGGGGATTTCAACCTAGACCTATTACAAGAAGACAAACAAACTAAAATGTATAAACAAATGCTTTGCGAAAATGGATATAAAATATTGAATAAAGTAGAAGAAGAATACTGTACAAGAGAAACGTCGACAACTAGGACAATTTTGGATCATGTTACAACAAATTTAAAGAATAAAAACGTACACTTAGCCATTGTTGAATCTTGTATGTCGGATCATAAACAAATTTACGTCGCAATAAAAAAACAACAAGTAATTTCAAAACAAAGGAGTAAATACGAGGCCATAGACTATAGCAGCCTATATAAAAAATTTGATTCAAGCAAATTAGACAATAGTAACTATGAATACAAACATTTAGAAGATGTTATAAAACAGAATATTCGTGAAAACACTAAGACAAAATCGAAAATACTTAATTTGCCACAACAGGACTGGATAACAAAAAATATCACTGATGGAATAAATAGAAGAAATAAACTGTGGTACAAGCTGAAAAAGGACCCGAATAATGAAGACCTCAAAGCTAATTTCAAAACTGAAAGAAACCAGGTAACGCGGGATATACAAAGCGCAAAGAGAAAATATTATCTGGATGCTTTCAATAAATGTTCCAAAAAACCGAAAAAGATGTGGAGCCTAATCAACACCTTAGCAACAAATAAACTGAAGAAAAAATGTCTGCTTCCCAAGATCCATTCTACTGAGGGTCGTATAATACAAGAAGATCACATATGTGAATATTTTAACAAGTTTTTCTCAACTGTAGGCACAACCTTGGCCGATAAAATTCCTCAGAAATTTCATGGAAATCATACGCATATCTTACCAAATAACTCTGTGACTAATGTTGTTCTACAAAAGCTTAATTTATGTACCTCAGATGAAATTGATAAACATATTGATAACTTGGACCCGAACACAAGTACGGGGATTGATGGTATTAGTGCAAAGACCCTCAAATGTTTAAAGAACGCTGTATGTCTCGTGTTATCACAATGCATTAACAAGTGTTTGAACGATGGTATATTTCCTGATAATCTTAAGATCGCCAAAGTCGTTCCAATTTTCAAAACAGGGTCTAGATCTGATGTTAACAATTATCGTCCCATATCAGTTCTACCCATACCATCTAAAATTTTCGAAAAAGTTCTTTATAATCGTCTCAATGAACACTTAACATCACTGAGTTTTCTTTCTGATCGCCAATACGGGTTTAGGCCAAAATCAAATACACTTTCAGCAACGATAGATCTAGTTACTACTATCAAAACAAACATTGATAAGAAAAACATGGTCTTAGGAGTGTTTATAGACCTAAAAAAGGCTTTTGACACAGTCAGTCACCCATTACTGTTGAAAAAACTAGAGAGCATTGGTGTGACCAATTCAGCTTACGAAATATTTAAGTCTTACTTGGAAAACAGGGTCCAGATGGTGAAAATTGATGATCATCAAAGATCTTTGCGCGGGACCGCCCAGTGTTTTCCTCGTCGAGTCTCTCTCATGATCTACAATTCGTTGGTTAAACCTCATCTTCAATATCTGATTGAGACAGTTACATCCATAGAAATGATAGTATTGTTACTTAAGCCTACGTTAATAACTAAAAATACTAAATTCAATTTAAAGTAA
Protein
MEAACLKRMEDLNQTHRRTSNSRILTKKLCASNKQSSTRIGILQIENISYQITNDYSQIETFYPSLNFLYANVRSIVKPGKFDELKCVLKSIDKGVHVVLLTETWIKSENDAMKLHLPNYTHHYSYRNDIRGGGVSIYVHNNIKHSTTEDKYSNGNNYLWVYLEQHGLHVGVVYKPGTTNTEDFLIDYEQQLHDRNRTIIFGDFNLDLLQEDKQTKMYKQMLCENGYKILNKVEEEYCTRETSTTRTILDHVTTNLKNKNVHLAIVESCMSDHKQIYVAIKKQQVISKQRSKYEAIDYSSLYKKFDSSKLDNSNYEYKHLEDVIKQNIRENTKTKSKILNLPQQDWITKNITDGINRRNKLWYKLKKDPNNEDLKANFKTERNQVTRDIQSAKRKYYLDAFNKCSKKPKKMWSLINTLATNKLKKKCLLPKIHSTEGRIIQEDHICEYFNKFFSTVGTTLADKIPQKFHGNHTHILPNNSVTNVVLQKLNLCTSDEIDKHIDNLDPNTSTGIDGISAKTLKCLKNAVCLVLSQCINKCLNDGIFPDNLKIAKVVPIFKTGSRSDVNNYRPISVLPIPSKIFEKVLYNRLNEHLTSLSFLSDRQYGFRPKSNTLSATIDLVTTIKTNIDKKNMVLGVFIDLKKAFDTVSHPLLLKKLESIGVTNSAYEIFKSYLENRVQMVKIDDHQRSLRGTAQCFPRRVSLMIYNSLVKPHLQYLIETVTSIEMIVLLLKPTLITKNTKFNLK

Summary

EMBL
BABH01005955    BABH01005956    BABH01005957    ODYU01002150    SOQ39280.1    GANO01002979    + More
JAB56892.1    GACK01000380    JAA64654.1    GACK01003878    JAA61156.1    GACK01003889    JAA61145.1    NWSH01000417    PCG76539.1    GFWV01022122    MAA46850.1    GACK01002596    JAA62438.1    AAGJ04008561    QNYJ01000098    RUA05525.1    GANO01004336    JAB55535.1    GEFM01002391    JAP73405.1    HAED01014535    SBR00980.1    GCES01133440    JAQ52882.1    GEHC01001019    JAV46626.1    NWSH01000358    PCG77029.1    DMQF01000155    HAO14484.1    GANO01004337    JAB55534.1    HADZ01003859    SBP67800.1    GEGO01003580    JAR91824.1    GACK01003803    JAA61231.1    GGMR01005613    MBY18232.1    HAEF01017628    SBR58787.1    QNYJ01000080    RUA05885.1    GEGO01003176    JAR92228.1    KZ149952    PZC76581.1    GEGO01003474    JAR91930.1    GEHC01001016    JAV46629.1    GBHO01036382    JAG07222.1    GACK01003815    JAA61219.1    GEGO01004245    JAR91159.1    GFWV01009040    GFWV01009041    MAA33769.1    LSMT01000021    PFX32582.1    GACK01009044    JAA55990.1    QNXQ01000100    RUM30450.1    GEGO01004368    JAR91036.1    HAEG01006811    SBR77686.1    LSMT01000382    PFX18982.1    DNUT01000355    HBI40644.1    DMQF01000079    HAO14226.1    GEGO01003806    JAR91598.1    LSMT01000002    PFX34724.1    DNUT01000184    HBI40005.1    ABLF02015076    ABLF02020029    ABLF02067202    MRZV01001199    PIK39803.1    GGMR01003557    MBY16176.1    LSMT01000016    PFX32997.1    ABLF02011184    ABLF02011185    GFAC01000112    JAT99076.1    GACK01010154    JAA54880.1    GEFM01002390    JAP73406.1    GDRN01100198    JAI58616.1    GFWV01001118    MAA25848.1    HAEC01001258    SBQ69335.1    GDHC01015476    JAQ03153.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF18701   DUF5641
PF05380   Peptidase_A17
PF00665   rve
PF17917   RT_RNaseH
PF10551   MULE
PF03258   Baculo_FP
PF00431   CUB
PF09588   YqaJ
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR000048   IQ_motif_EF-hand-BS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR040676   DUF5641       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR011011   Znf_FYVE_PHD       
IPR019786   Zinc_finger_PHD-type_CS       
IPR018289   MULE_transposase_dom       
IPR004941   Baculo_FP       
IPR001965   Znf_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR019787   Znf_PHD-finger       
IPR000859   CUB_dom       
IPR035914   Sperma_CUB_dom_sf       
IPR007527   Znf_SWIM       
IPR011604   Exonuc_phg/RecB_C       
IPR011335   Restrct_endonuc-II-like       
IPR019080   YqaJ_viral_recombinase       
IPR029526   PGBD       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
SSF50630   SSF50630       
SSF57903   SSF57903       
SSF49854   SSF49854       
SSF52980   SSF52980       

Ontologies

Topology

Length:
744
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.30389
Exp number, first 60 AAs:
0.00033
Total prob of N-in:
0.00039
outside
1  -  744
 
 

Population Genetic Test Statistics

Pi
227.736515
Theta
198.0596
Tajima's D
3.092007
CLR
0.159305
CSRT
0.982600869956502
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号