SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12481
Pre Gene Modal
BGIBMGA001472
Annotation
PREDICTED:_bumetanide-sensitive_sodium-(potassium)-chloride_cotransporter-like_[Bombyx_mori]
Full name
Bumetanide-sensitive sodium-(potassium)-chloride cotransporter      
Alternative Name
Na-K-CL symporter
Location in the cell
PlasmaMembrane   Reliability : 4.82
 

Sequence

CDS
ATGGAAGATAATAGATTTGTCGTTTCAACCGTGGAGGGGGAATGTAAGAAGAATGGTATCCACATGGGAGCTAATATCATATCTCGTCCACTACGGTCTTCCTTGGAGACTGTCGAGCGAGGAGTTACCAACGCGCAGCCGGACACCTGGCTCCACGATGCCGGCTGGAGGAGAAAACGCTCTCTGGCACAGCTGACAAGGGAAGCGCTCCCCAGAATGGAAAACTACAGAAATTCGAAGAGAGCCCTGAAAAGACCTAGTTTAGGTGAACTACACGGTGACCACCTAATAACTGAAGAGGAAGAGAAAACGCAGAATCCGAGAGACACAAAATCACCGACACCAGCCGGTGGAATCAAATTAGGATGGATACAAGGTGTGTTGATACCATGTCTCCTGAACATCTGGGGCGTGATGCTGTTCCTCCGTATCTCGTGGGTGGTGTCGCAGGCCGGCATTGGCTGGTCCCTGGTCATCATTGCACTATCAGCTGTTGTGTGCGTCATCACCACGCTATCTATGAGCGCAATTTGCACCAATGGAGAAGTAAAAGGAGGCGGCATTTACTACATAATATCAAGATCTCTCGGCCCAGAATTCGGGGCTTCTGTGGGCATAATATTTGCTTTTGCCAACGCCGTGGCCGCGAGCATGAACACCATCGGTTTCTGTGACTCCATGAACCACCTCCTCAAGAGCTTAGACCTGCAAATAATCGACAACAGCTACAACGACGTGAGGATCATCGGCGCCATAGCCTTATTCGTGATGTGCGTCATCTGCGCTGTCGGAATGGACTGGGAGAGTAAAGCGCAGAATTTCTTGATCGCGATTATAGTGGGCGCAATCGTCGACTTCGTTGTTGGTGCGGTCATGGGTCCGAAGAGTAACTTGGAGGTTGCAGAAGGATTTGTCGGCTTAAGTACATCAACGTTCGTAGAAAACTTCAATTCTGACTTCAAATACAGTGAGGGCATGGAGCAGAACTTCTTCAGTGTCTTCGCCATATTCTTTCCATCCGTGACCGGAATACAGGCAGGCGCGAATATATCTGGCGATCTGAAGGACCCCGCATCCGCCATACCAAAAGGCACGTTATTAGCGCTCCTAATATCTATGGTGAGCTACGCTATGATGGTTTTATTCACCGGAGCCGCAGCCCTCCGTGACGCGAGCGGAAATATCACTGACCTGGTCATCAGCAACGGCACAGTTACAAATTACAGTGCGATCATGCAACTGATGTCGGCGTGGGGCCCCTTCATCTACGCGGGCTGCTGGGCGGCGACTCTGTCCACGGCGCTCACCAACCTGCTGTCGGTGCCGCGACTCATCCAGGCGCTCGGCGTCGACCGCATCTACCCAGGACTCATCTTCTTCTCGAAACCGTACGGACGACACGGAGAAGCCTACAGAGGATACGTGCTCACCTTCTTAGTGTCCTTACTGTTTCTACTTATTGCGAAATTAAATGCGATCGCGCCATTGATCTCCAATTTCTACCTGGCATCATATGCGCTGATAAACTTTTGCACGTTTCACGCGGCGCTGGTGCGGCCTCTTGGCTGGCGACCTACATTCAAATACTACAATGTTTGGGTGTCCCTGGCCGGTTTCCTGATGTGTGTCGGGATCATGTTGCTCATCAGCTGGATCATGTCGCTCGTGACCATTGCAATATTCTTCACGCTGTATCTCATCGTGCACTACCGTAATCCCGATGTGAACTGGGGCAGTAGCACGCAAGCTCAGATGTACAAGACGGCGTTGTCCAGTGCCCACAACCTGGCCCGCACTGGGGAGCACGTGAAGAACTACTGGCCGCAACTGCTGGTGCTGGGGGGACGCGCCCACGCTCGTCCGCCGCTCGTAGACCTGGGTAGCCTCATCACCAAAGCCGGCTCTCTTATGATCATTGGAGATATTTCGAAGGAAAAACTGTCATACAAGGTGTGCTCAGCGCGAGCTCGTGCAGATAACGAATGGCTGCAAGAGAGGAAAGTGCGCGCCTTCTGTTCGCTAGTGCACGGATTCAACTTTGAACAAGGAGCACGAGCCCTGATACAGGCGACCGGCGTCGGCAAACTGGCGCCCAACGTGTTACTCATGGGCTACAAGTCAGATTGGACAACAGCTTCGGCCGAAGACCTCGTTGCTTATTTCAATGTGTTACACACGGCGTTCGAGAACCGTCTGGCCGTCGCTATAGTCCGTGTGCGCGGCGGGCTGGACTACGGCGCGGCGGGGGGTGGGGAAGAGGGCGCGGGGTCGCTGACCGTCACGTCGAGCGGTTCGGGCGAGCTACACGTGCGCCGCTCAGACGCGCTCATCATGCACGCGGACTCAGACCTCGACATCCACACCGACTCCTCCGCCAAGAACAATCTTTCCAATATTTTAACACTGTCCACTTCGCGATCGTTCACAATAACTGATGCCAAAGACATAAAAGATAAGAAAAAGAAAGACAAAAGGCCCACCGACATGCATCGTCAGATCATCTACAACGCGGCGAACGGAATTGAACTGTCTAAAGATCAATTAACTCAGATGTCAATATTTAAACGGAAACAGGAATCCGGGACGGTGGACGTGTGGTGGCTATACGACGACGGCGGCCTCACAATCCTGCTCCCGTACATCATCTCGCAACGATCCGCCTGGGGGAACTGCAAACTTCGTATATTCGCACTCGCTAACCGACTCAACGAAATGGAGCTCGAAGAAAGAAATATGGCCAATTTACTGTCGAAGTTCCGGATTGACTATTCGTCGTTGACAATGGTCCAAGACATAACGGAACCTCCGCAAGCAGAGACCAAAGCGCTCTTCGATGAGACCATAAAGAAATTTACAAGTGATTCTGCTGCCCCAGAGTGTCGTATTAGCGAGACGGAGTTGACGACGCTATCCGGTAAGACGAATAGGCAGCTGCGACTGAGGGAGCTTTTACTCGCCAACTCAAGGGACTCGAGGCTCATCGTTATGTCGCTACCCATGCCCAGAAAGGGCTCCGTGTCAGCGCCGCTGTACATGGCGTGGCTAGAGATGATGAGTCGTGACCTGCCGCCGATGCTCTTCGTACGAGGGAACCACACTTCAGTGCTCACGTTCTATTCTTGA
Protein
MEDNRFVVSTVEGECKKNGIHMGANIISRPLRSSLETVERGVTNAQPDTWLHDAGWRRKRSLAQLTREALPRMENYRNSKRALKRPSLGELHGDHLITEEEEKTQNPRDTKSPTPAGGIKLGWIQGVLIPCLLNIWGVMLFLRISWVVSQAGIGWSLVIIALSAVVCVITTLSMSAICTNGEVKGGGIYYIISRSLGPEFGASVGIIFAFANAVAASMNTIGFCDSMNHLLKSLDLQIIDNSYNDVRIIGAIALFVMCVICAVGMDWESKAQNFLIAIIVGAIVDFVVGAVMGPKSNLEVAEGFVGLSTSTFVENFNSDFKYSEGMEQNFFSVFAIFFPSVTGIQAGANISGDLKDPASAIPKGTLLALLISMVSYAMMVLFTGAAALRDASGNITDLVISNGTVTNYSAIMQLMSAWGPFIYAGCWAATLSTALTNLLSVPRLIQALGVDRIYPGLIFFSKPYGRHGEAYRGYVLTFLVSLLFLLIAKLNAIAPLISNFYLASYALINFCTFHAALVRPLGWRPTFKYYNVWVSLAGFLMCVGIMLLISWIMSLVTIAIFFTLYLIVHYRNPDVNWGSSTQAQMYKTALSSAHNLARTGEHVKNYWPQLLVLGGRAHARPPLVDLGSLITKAGSLMIIGDISKEKLSYKVCSARARADNEWLQERKVRAFCSLVHGFNFEQGARALIQATGVGKLAPNVLLMGYKSDWTTASAEDLVAYFNVLHTAFENRLAVAIVRVRGGLDYGAAGGGEEGAGSLTVTSSGSGELHVRRSDALIMHADSDLDIHTDSSAKNNLSNILTLSTSRSFTITDAKDIKDKKKKDKRPTDMHRQIIYNAANGIELSKDQLTQMSIFKRKQESGTVDVWWLYDDGGLTILLPYIISQRSAWGNCKLRIFALANRLNEMELEERNMANLLSKFRIDYSSLTMVQDITEPPQAETKALFDETIKKFTSDSAAPECRISETELTTLSGKTNRQLRLRELLLANSRDSRLIVMSLPMPRKGSVSAPLYMAWLEMMSRDLPPMLFVRGNHTSVLTFYS

Summary

Catalytic Activity
H2O + O-phospho-L-tyrosyl-[protein] = L-tyrosyl-[protein] + phosphate
Similarity
Belongs to the SLC12A transporter family.
Keywords
Chloride   Glycoprotein   Ion transport   Membrane   Potassium   Potassium transport   Sodium   Sodium transport   Symport   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Bumetanide-sensitive sodium-(potassium)-chloride cotransporter
EMBL
BABH01005908    BABH01005909    BABH01005910    BABH01005911    BABH01005912    BABH01005913    + More
KM111607    AIS39469.1    U17344    NWSH01001068    PCG72815.1    AGBW02012606    OWR44727.1    KQ459564    KPI99651.1    RSAL01000055    RVE49975.1    KQ461068    KPJ09892.1    GEZM01009755    JAV94333.1    AJWK01006428    KQ971312    KYB29205.1    GECZ01030739    GECZ01015000    JAS39030.1    JAS54769.1    PCG72814.1    GECU01006426    JAT01281.1    APGK01010025    APGK01010026    APGK01010027    APGK01053218    APGK01053219    APGK01053220    KB741223    KB738096    ENN72321.1    ENN82770.1    KB630198    KB631707    ERL83470.1    ERL85501.1    GFDF01009551    JAV04533.1    GFDF01009552    JAV04532.1    GDKW01001818    JAI54777.1    DS235750    EEB16309.1    GFTR01008462    JAW07964.1    UFQT01000100    SSX19929.1    GFDL01004689    JAV30356.1    GAPW01000083    JAC13515.1    CH477621    EAT38198.1    KQ414671    KOC64262.1    JXUM01000651    JXUM01000652    JXUM01000653    JXUM01000654    JXUM01000655    JXUM01000656    JXUM01000657    JXUM01000658    JXUM01000659    JXUM01000660    KQ560109    KXJ84476.1    GBHO01013124    JAG30480.1    GDHC01015659    JAQ02970.1    DS231976    EDS30058.1    KK853171    KDR10319.1    GL434776    EFN74573.1    NNAY01000772    OXU26603.1    CH916369    EDV92859.1    KQ435936    KOX68349.1    CH933806    EDW14873.1    CH940650    EDW68151.1    GBYB01001143    JAG70910.1    CH902617    EDV41914.1    KQ435131    KZC14865.1    CH954181    EDV47894.1    AE014297    AY122102    AAF52017.2    AAM52614.1    CP012526    ALC46644.1    CM000070    EAL28501.1    CM000160    EDW95778.1    CH964272    EDW84229.1    CH479182    EDW34269.1    KQ976933    KYN07006.1    GL450951    EFN80216.1    KZ288358    PBC27049.1    KQ982173    KYQ59378.1    AAF52018.2    KQ980341    KYN16434.1    GAMC01013964    GAMC01013961    JAB92594.1    KK107364    EZA51905.1    KY921816    ART29405.1    GAKP01016429    GAKP01016423    JAC42529.1    CVRI01000047    CRK98147.1    GFDG01001165    JAV17634.1    GFDG01002723    JAV16076.1    GFDG01001155    JAV17644.1    GFDG01002849    JAV15950.1    GDHF01026214    GDHF01021482    GDHF01008314    JAI26100.1    JAI30832.1    JAI44000.1    KA646937    AFP61566.1    OUUW01000008    SPP84373.1    ADTU01012293    ADTU01012294    KQ976547    KYM80928.1    AXCM01001650    GFDG01002850    JAV15949.1    KQ981744    KYN36441.1    JRES01000249    KNC32985.1    EAT38199.1    CH480821    EDW54956.1    ATLV01019917    ATLV01019918    KE525285    KFB44724.1    KPU79431.1    AXCN02000174    AAAB01008794    EAL42059.4    GGFM01006391    MBW27142.1    GGFM01000175    MBW20926.1    GGFM01006394    MBW27145.1    EDS30057.1   
Pfam
PF00324   AA_permease        + More
PF03522   SLC12
PF00102   Y_phosphatase
PF08403   AA_permease_N
Interpro
IPR004842   SLC12A_fam        + More
IPR004841   AA-permease/SLC12A_dom       
IPR018491   SLC12_C       
IPR002443   SLC12A1/SLC12A2       
IPR016130   Tyr_Pase_AS       
IPR003595   Tyr_Pase_cat       
IPR029021   Prot-tyrosine_phosphatase-like       
IPR000242   PTPase_domain       
IPR020846   MFS_dom       
IPR000387   TYR_PHOSPHATASE_dom       
IPR013612   AA_permease_N       
IPR023298   ATPase_P-typ_TM_dom_sf       
SUPFAM
SSF52799   SSF52799        + More
SSF81665   SSF81665       
Gene 3D

Ontologies

Topology

Subcellular location
Membrane  
Length:
1040
Number of predicted TMHs:
11
Exp number of AAs in TMHs:
247.3163
Exp number, first 60 AAs:
0
Total prob of N-in:
0.87625
inside
1  -  120
TMhelix
121  -  142
outside
143  -  156
TMhelix
157  -  179
inside
180  -  199
TMhelix
200  -  222
outside
223  -  247
TMhelix
248  -  267
inside
268  -  273
TMhelix
274  -  293
outside
294  -  329
TMhelix
330  -  352
inside
353  -  364
TMhelix
365  -  387
outside
388  -  416
TMhelix
417  -  439
inside
440  -  474
TMhelix
475  -  497
outside
498  -  500
TMhelix
501  -  523
inside
524  -  529
TMhelix
530  -  552
outside
553  -  1040
 
 

Population Genetic Test Statistics

Pi
224.916833
Theta
165.54689
Tajima's D
1.180486
CLR
0.291198
CSRT
0.703614819259037
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号