SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12480
Pre Gene Modal
BGIBMGA001473
Annotation
PREDICTED:_bumetanide-sensitive_sodium-(potassium)-chloride_cotransporter-like_isoform_X1_[Papilio_xuthus]
Location in the cell
PlasmaMembrane   Reliability : 4.874
 

Sequence

CDS
ATGGACGTACGTTTGCTAGGGGACTGTGGGAAAATGGTTCCCAAATCAATGTTGAGACGCAGGCGAAGTGAGTCTGTCGAAATCGGAAACACTAATTGCGAAGTAAATTCCGAAGAAAACGAGAGCAGAAGCACTCGGGAATATAGCAATGGACATTTGCATCCTACTCCGGAACTAACAACGTATGGAGGGATAAAATTAGGATGGATTCAGGGTGTATTGATACCATGTCTCCTCAACATTTGGGGTGTTATGTTGTTTTTACGGATCGCGTGGGTCGTGGCGCAAGCTGGTATAGGTCTTTCGGTCATAATTGTATTCCTTTCCGCCATAGTCTGCGTTATCACGACTCTGTCTCTGAGCGCAATATGCACCAACGGACAACTACAAGGAGGTGGAGTATACTATCTTGTCTCGAGATCACTGGGGGCCGAATTTGGGGCGTCAGTCGGAATACTCTTTGCATTCGCCAACGCTGTAGCGGCCAGTATGAACACTATCGGATTTTGTGATTCTCTAAATCACCTCCTGAAGACGCACGGACTGAAAATCGTTGATAACGACGTAAACGATATCAGGATTGTGGGTGCGGTAGCGCTTTTAGTTATGTGCGTAATTTGTGCCATTGGTATGGACTGGGAAACCAAAGCGCAGAATTTTCTAATAGTCGTAATAGTAGTGGCGATAATAAATTACATTGTCGGAGCACTTATAGGACCCAGTAGTGATGTAGAAAGAGCAAAAGGATTTGTGGGAATAAATTTACAAACTATTCGGGAGAACTGGCTCCCGAATTTTCGCTACAGCGAAGGGCGCGAACACGACTTCTTCAGTGTTTTCGCGGTTTACTTCCCCGCCGTGACTGGCGTGCAGGCGGGGGCCAACATTTGTGGAGATCTCAAGAACCCAGCCGTCGCAATTCCCAAAGGTACTCTTTTAGCGCTGGCCATATCAGTCACGTCGTATTTCACAATGGTGATTCTGTCGGGAATGGGTGCCCTCAGGGACGCGAGCGGTAACGTCGCGAACTTGACAACAGCCGCGCTCGAATCTTGCAAACCTCACTGCGGTTACGGCTTACACAATAACTATGCGATCATGCAGTTAATGTCGGCTTGGGGCCCCTTCATCTACGCGGGCTGCTGGGCGGCGACTCTGTCCACGGCGCTCACCAACTTGCTGTCGGTGCCGCGGCTCATCCAGGCGCTCGGCGTCGACCGCATCTACCCAGGACTCATCTTCTTCTCGAAACCGTACGGACGACACGGAGAGCCCTACAGAGGATACGTACTAACCTTTTTCGTTTCCTTACTGTTTCTACTTATCGCGAATTTGAACGCGATTGCTCCGTTGATAACAAATTTTTACTTGGCCTCATACGCACTTATTAACTTTTGCACCTTTCACGCGGCATTCGTTCACCAAATTAATTGGCGACCCACGTTTCGCTATTACAACAAATGGCTATCGTTGGCCGGGTTCCTAATGTGTGCTTCAATAATGATGATAATCAGCTGGGCGATGGCACTGACTACAATGTTTGTTTTCATGACATTATATCTTCTCGTTCTTTATAGGAAGCCAGACGTGAGCTGGGGTAGCAGCACTGAAGGACAACGTTACCAGGACACGGTCTCATTTATAACTGAGCTCAGTCACCGAGTGACGCACAGTCGCTCGTACAACCCTCAGCTGCTTGTGCTCGCTGGGACACCGCTACAGCGCCCCGCGCTCATCGACGTAGCACACATGCTCACGAAGATAGGATCATTCATGATAGTTGCTGACATTACAGACACTGCATTAACCAAAGGCGAACGTGTCAGCCGTCAGCACATAGGCGAGCAGTTTGTGAAGTATCGCAAACTCCGCGCGTTCTACGTTCTCCTGCAAGGGCTTGACTTGAAGCGCGGCGCCAACGCACTGATGCAAGCTAGTGGGCTTGGAAAACTCTCTCCTAACATATTACTCATAGGATTCAAAAAGGACTGGACGAACGCTGAACATAAACAGATTAGCGACTACTACGGAGTTATCCAAGACGCATTCGATTTGAAGCTTGCGGTAACGATACTGCGAGTCCCCGGGACCTCGCAAACAGTACAGCGGTGGAGGTGGACACCCCGTGTGGTCTCGGAACCGAATAACTTCGAGCTCGTGATGCACACACAAGTACTCGCCCTCATGAACTCTGATTCAGACCTCGAAGACGACGACCAAGCAATCGACGATGATTCTGACAAACTTATCGACTCTGAAAACCAGCTGTCAAACGAAACTTCAAGTAGCGAACAGAATCCAGAATCCATCGGCGGAGAAGCATTACGATCTGCGAACTTTTCCCGGACTTCAAGACGGAAACTTTCAAACGGAGCTTTGTCATTCAGAGCTTTGTCGTTCAATTGCAAACAATACGTAGATGCTTGGTGGCTTTATGAGGATGGTGGTTTGAACATATTGCTTCCGTATATTATTGCACGTCGCGGCTACAAACACAAACTGCCCCTTAGGATATTCGCGATCACGAAAGAACAGCACAAAAGAGAGTTTGAAAATAAATGCATGGAAAGTTTATTGAAAAAATTTCGAATCGAGTACACGGAGCTGACACTGGTGCGAGGGATTGGGGACGCGCCACCCGAGTCGAGTTGGAAAATGTTCAACAACATCATAAACGATTTTAAGTCTGAGGAGAAAACTGATATTTTAACATCGGAAGCCGAGTTGAAGAGTCAGTACAGTAAAACGAGCAGGCATTTGCGACTACGAAACCTTCTGTTGCAACATTCGACAAAAGCCGCTATCGTCATCATTACCCTGCCATTGCCGAGAAAGGTGTCGGCATCGCTGTACATGGCGTGGCTAGAGGTCCTCAGCCGAGATTTGCCGCCCGTGTTATTCGTACGTGGCAACGACTCCTGTGTGTTGGACGCGTAA
Protein
MDVRLLGDCGKMVPKSMLRRRRSESVEIGNTNCEVNSEENESRSTREYSNGHLHPTPELTTYGGIKLGWIQGVLIPCLLNIWGVMLFLRIAWVVAQAGIGLSVIIVFLSAIVCVITTLSLSAICTNGQLQGGGVYYLVSRSLGAEFGASVGILFAFANAVAASMNTIGFCDSLNHLLKTHGLKIVDNDVNDIRIVGAVALLVMCVICAIGMDWETKAQNFLIVVIVVAIINYIVGALIGPSSDVERAKGFVGINLQTIRENWLPNFRYSEGREHDFFSVFAVYFPAVTGVQAGANICGDLKNPAVAIPKGTLLALAISVTSYFTMVILSGMGALRDASGNVANLTTAALESCKPHCGYGLHNNYAIMQLMSAWGPFIYAGCWAATLSTALTNLLSVPRLIQALGVDRIYPGLIFFSKPYGRHGEPYRGYVLTFFVSLLFLLIANLNAIAPLITNFYLASYALINFCTFHAAFVHQINWRPTFRYYNKWLSLAGFLMCASIMMIISWAMALTTMFVFMTLYLLVLYRKPDVSWGSSTEGQRYQDTVSFITELSHRVTHSRSYNPQLLVLAGTPLQRPALIDVAHMLTKIGSFMIVADITDTALTKGERVSRQHIGEQFVKYRKLRAFYVLLQGLDLKRGANALMQASGLGKLSPNILLIGFKKDWTNAEHKQISDYYGVIQDAFDLKLAVTILRVPGTSQTVQRWRWTPRVVSEPNNFELVMHTQVLALMNSDSDLEDDDQAIDDDSDKLIDSENQLSNETSSSEQNPESIGGEALRSANFSRTSRRKLSNGALSFRALSFNCKQYVDAWWLYEDGGLNILLPYIIARRGYKHKLPLRIFAITKEQHKREFENKCMESLLKKFRIEYTELTLVRGIGDAPPESSWKMFNNIINDFKSEEKTDILTSEAELKSQYSKTSRHLRLRNLLLQHSTKAAIVIITLPLPRKVSASLYMAWLEVLSRDLPPVLFVRGNDSCVLDA

Summary

EMBL
NWSH01001068    PCG72813.1    KQ459564    KPI99652.1    PCG72815.1    KK853171    + More
KDR10319.1    AJWK01006428    CH477621    EAT38198.1    GAPW01000083    JAC13515.1    JXUM01000651    JXUM01000652    JXUM01000653    JXUM01000654    JXUM01000655    JXUM01000656    JXUM01000657    JXUM01000658    JXUM01000659    JXUM01000660    KQ560109    KXJ84476.1    GFDL01004689    JAV30356.1    DS235750    EEB16309.1    DS231976    EDS30058.1    GECZ01030739    GECZ01015000    JAS39030.1    JAS54769.1    EDS30057.1    EAT38199.1    GDHC01015659    JAQ02970.1    GBHO01013124    JAG30480.1    CH479182    EDW34269.1    KB630198    KB631707    ERL83470.1    ERL85501.1    CM000070    EAL28501.1    APGK01010025    APGK01010026    APGK01010027    APGK01053218    APGK01053219    APGK01053220    KB741223    KB738096    ENN72321.1    ENN82770.1    CH916369    EDV92859.1    CH933806    EDW14873.1    CP012526    ALC46644.1    CH940650    EDW68151.1    GAMC01013964    GAMC01013961    JAB92594.1    GDHF01026214    GDHF01021482    GDHF01008314    JAI26100.1    JAI30832.1    JAI44000.1    GAKP01016429    GAKP01016423    JAC42529.1    CH964272    EDW84229.1    KA646937    AFP61566.1    KY921816    ART29405.1    AXCM01001650    AAAB01008794    EAL42059.4    CVRI01000047    CRK98147.1    AXCN02000174    GGFM01006391    MBW27142.1    GGFM01000175    MBW20926.1    APCN01002153    GGFM01000210    MBW20961.1    EDO64829.2    GGFL01003443    MBW67621.1    ADMH02000281    ETN67130.1    GL434776    EFN74573.1    ATLV01019917    ATLV01019918    KE525285    KFB44724.1    GFDL01003571    JAV31474.1    KA649571    AFP64200.1    JRES01001238    KNC24410.1    AAAB01008987    GGFM01000684    MBW21435.1    GGFM01000216    MBW20967.1    GGFK01000205    MBW33526.1    GGFK01000189    MBW33510.1    APCN01000883    AJ439353    CAD27923.1    EAA00828.4    GGFJ01001059    MBW50200.1    GGFJ01001558    MBW50699.1    KQ971361    EFA05305.2    AXCN02001150    KDR10326.1    GAKP01021184    JAC37768.1    GDHF01010819    GDHF01004981    JAI41495.1    JAI47333.1   
Pfam
PF00324   AA_permease        + More
PF03522   SLC12
PF08403   AA_permease_N
Interpro
IPR018491   SLC12_C        + More
IPR004841   AA-permease/SLC12A_dom       
IPR002443   SLC12A1/SLC12A2       
IPR004842   SLC12A_fam       
IPR013612   AA_permease_N       
IPR023298   ATPase_P-typ_TM_dom_sf       
SUPFAM
SSF81665   SSF81665       

Ontologies

Topology

Length:
978
Number of predicted TMHs:
11
Exp number of AAs in TMHs:
242.082000000001
Exp number, first 60 AAs:
0.0035
Total prob of N-in:
0.77390
inside
1  -  70
TMhelix
71  -  93
outside
94  -  102
TMhelix
103  -  125
inside
126  -  145
TMhelix
146  -  168
outside
169  -  191
TMhelix
192  -  211
inside
212  -  219
TMhelix
220  -  242
outside
243  -  275
TMhelix
276  -  298
inside
299  -  310
TMhelix
311  -  333
outside
334  -  371
TMhelix
372  -  394
inside
395  -  429
TMhelix
430  -  452
outside
453  -  456
TMhelix
457  -  476
inside
477  -  487
TMhelix
488  -  510
outside
511  -  978
 
 

Population Genetic Test Statistics

Pi
180.73743
Theta
146.316978
Tajima's D
0.50412
CLR
0.477912
CSRT
0.51632418379081
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号