SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12443  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002365
Annotation
Endoprotease_FURIN_[Spodoptera_frugiperda]
Full name
Furin-like protease 2      
Location in the cell
Extracellular   Reliability : 3.398
 

Sequence

CDS
ATGAACGTGGCGCCAGCATGGCAAAAGGGATATACAGGCAAGGGCGTTGTAGTGTCAATATTAGATGACGGAATACAAACAAACCATCCAGATTTAGCACAGAATTACGATCCTCTAGCATCGACGGACATAAACGGCAACGATGATGACCCTATGCCACAGGACAATGGCGACAATAAACACGGCACAAGGTGTGCAGGCGAAGTCGCAGCTGTCGCTTACAATCGCTACTGTGGTGTGGGTATTGCCTACAACGCCAGCATAGGAGGAGTTAGGATGTTAGATGGAATTGTCAATGATGCAGTAGAAGCAAGAGCGTTGGGATTGAATCCAGATCATATTGACATCTATAGCGCTTCCTGGGGACCGGAAGACGATGGCAAAACAGTTGACGGTCCTGGACCTTTGGCCAGAAGAGCATTTATATATGGTGTTACGAGCGGTCGTCGTGGCAAAGGCTCTATCTTTGTCTGGGCTTCCGGTAACGGCGGAAGGCACACCGATTCATGTAACTGTGACGGCTACACAAACAGCATATTTACTCTATCGATATCTAGTGCAACACAAGGAGGCTACAAACCTTGGTATCTCGAAGAATGTTCTTCCACTTTAGCTACCACTTACAGTTCGGGTACTCCGGGTCACGACAAAAGTGTGGCGACTGTTGATATGGACGGTAGACTGAGGGCTGACCACATTTGTACAGTAGAACACACGGGAACTTCAGCTTCTGCACCATTAGCAGCTGGAATATGTGCTTTAGCTCTTGAAGCAAATCCTGAATTAACATGGAGAGATATGCAATATCTGGTTGTAATGACGTCTAGGCCTGAACCGTTAGAAAGAGAAAAGGGTTGGATCATCAATGGAGTCAAGAGGAAAGTTAGTCACAAATTCGGATACGGTCTTATGGATGCCACGGAAATGGTAAATTTGGCCGAGCAGTGGGTAACGGTTCCACCTCAACATATCTGTAAATCGCAGGAGTTGAACGAAGACAAGTCGATGGACTCTACTTTGGGCAATTCATTAAGGACATATATGGATGTAACTGGATGCAGTGGTACGGTGAATGAAGTGCGTTACCTAGAACATGTCCAATGTAAAATATCGTTGAGGTTCTTCCCCCGTGGTAACCTGCGTATATTATTAACTTCACCAATGGGTACTGTATCAACATTATTGTTCGAACGACCTCGTGACGTGGCTAGTTCTACCTTCGACGATTGGCCATTTTTGAGCGTTCATTTTTGGGGAGAACAAGCAGAAGGTAGATGGACATTAGAAATAATAAACGCCGGCAAAAGGCACGTGAACCAGGCGGGCGTTCTCAAGAAATGGCAGCTGATATTCTACGGAACTGTCATAGATCCCGTTCGGTTACGATCAAAGAGACCGTCGCCATTTGCACCGTCATACGCGTTTCCAACGGCAGCGGATGGCTACGACACAATCAGTGATTCTTTTTACAATACTGACGCGTTTGCTAATTACCAGAACTTTCCAAATTTATTCGCCGCTGGGTCCAACCCGGAAAAGGCGGTAGCCCGTCTCGACGGACATAACGTCCCTTCACCGCATGGGGAAAATGTCCTCGCCGATAGTAATGACAAGCGCGTCATGCACGACTGTGATCCCGAATGCGATTCTCAAGGATGCTACGGAAAAGGACCGTCCCAATGTGTGGCTTGTAAACATTACCGTTTAGATGACACGTGCGTTTCTCGTTGCCCACCGAGAAGCTATGCCAATCAAGGGGGAGTTTGTTGGCAATGTCACGAATCGTGTGAAACTTGCATGGGACCGGGGCAAGATTCATGTTTCACATGTGCTCCGGCTCATTTTTTAGTGGCAGATTTGGCTGTTTGCCTACAACAATGTCCTGATGGATATTGGGAGGACACAGATTCTGCAACTTGTCGGCCTTGTGCAGCTCATTGTGCGACTTGTTCGGAAAGAGCGAATGCGTGCACGTCGTGTGAACATCACCTACTCCTGCACGAGGGCAGCTGTCTGGTCACATGTCCGGCAGCGCACTACGAAACCGACGATTACACTTGCGCCAAATGCCACAATTCGTGTGACACATGCGTTGGACCAAAGGAAAACCAATGCATAACTTGTCACACTACAAATTACGTGTTAGATGGTAGCTGTGTGGCGACATGTCCAGGCGGATATTACGTGGACAAAAAAAGGAAGGAATGCGTGAGGTGTCCAGTTGGATGTGCGACTTGCACAAGCGCTTTCTGTCTCACATGCGAAACAAATTGGGAAATAAATAAGAAGGGGAGATGTCTCCCAGCTGGATCTGATCGATGTTCGACCGGACAATTCATAGATAAACTCGGCTGTAGCAGATGTGACGACGCTTGTGAATCGTGCTATGGAGAGGGCGAAGGACACTGTCTAACTTGTCCATCGCCTAATTTGCTAGAAGATTACAGATGCGTTCCGGAATGTAGCAGCGGATATTACGCGGAGGCCGGTCGGTGCATTCGCTGCGTGCACGGTTGTACTGAATGCGTTTCAAGACTCAACTGTACCAGCTGTGCTGGGTCCCTGAGACTGCAGTCTGGAGCTTGCAGGACTTCATGCGCTGATGGGTACTACGCTGATCGCGGCGCCTGTTCCAAGTGCTATTTATCTTGCCGGACATGTATTGGGCCCCGTCGCGATCAGTGCGCGTCCTGCCCTCAGGGTTGGAGGCTAGCCGCTGGAGAATGTCACCCCGAATGTCCTCAAGGATTCTACAAAAGCGACGACGGCTGCCGTCATTGTCACCACTACTGCCGGGAGTGCTCGGACTCCGGTCCGCTACACTGCACGTCGTGTCCGCCTCGTTTCGTGTTAGACGGCGGGCTTTGTATGGAGTGCCTCGGCTCTCAGTACTACGAGGCGGGCAATGGAACGTGCAGCACGTGCGATCCGTCGTGTCGCACCTGCTACGGTTCGGGACAGTTCAGTTGTACAGGATGCTCCAGGCCGCTGAGGCTCGATAGATTAAACAATCAGTGCGTTCCGTGTTGTACGGACAGGGGGACGACGACCTCGCCCGGGACCGAATGCTGCCATTGTCATCCCGAAACTGGTGAATGCATTAACTCATCGGTGGCGGGAAAACGTCGTATAGCCGAATGGGGCGCTCTGCACACAGTGGAGAACGCTCGCAGTACGTCAGCTCCCAGCGCCGCCGCGATAACCGTCATGGTGTGTCTGTCCGCCGGTGCACTGTTCTTTGTCGTGCTGATGATACTACAGTGGCGTTCACCGCGCGACAAGCGAACACGAACCCGCGGGCTCGTCTACTACCCCCTCGCCTACAACGACGACGGCAAGGTTGTCGTCCTTGCTCCGCATACGGCGTTCCCCTCAAGCGAGAGCAGGACGGAGGAACTACACGAGCACGAAGACGAACCGTTGCTCGAACATTCCACATAG
Protein
MNVAPAWQKGYTGKGVVVSILDDGIQTNHPDLAQNYDPLASTDINGNDDDPMPQDNGDNKHGTRCAGEVAAVAYNRYCGVGIAYNASIGGVRMLDGIVNDAVEARALGLNPDHIDIYSASWGPEDDGKTVDGPGPLARRAFIYGVTSGRRGKGSIFVWASGNGGRHTDSCNCDGYTNSIFTLSISSATQGGYKPWYLEECSSTLATTYSSGTPGHDKSVATVDMDGRLRADHICTVEHTGTSASAPLAAGICALALEANPELTWRDMQYLVVMTSRPEPLEREKGWIINGVKRKVSHKFGYGLMDATEMVNLAEQWVTVPPQHICKSQELNEDKSMDSTLGNSLRTYMDVTGCSGTVNEVRYLEHVQCKISLRFFPRGNLRILLTSPMGTVSTLLFERPRDVASSTFDDWPFLSVHFWGEQAEGRWTLEIINAGKRHVNQAGVLKKWQLIFYGTVIDPVRLRSKRPSPFAPSYAFPTAADGYDTISDSFYNTDAFANYQNFPNLFAAGSNPEKAVARLDGHNVPSPHGENVLADSNDKRVMHDCDPECDSQGCYGKGPSQCVACKHYRLDDTCVSRCPPRSYANQGGVCWQCHESCETCMGPGQDSCFTCAPAHFLVADLAVCLQQCPDGYWEDTDSATCRPCAAHCATCSERANACTSCEHHLLLHEGSCLVTCPAAHYETDDYTCAKCHNSCDTCVGPKENQCITCHTTNYVLDGSCVATCPGGYYVDKKRKECVRCPVGCATCTSAFCLTCETNWEINKKGRCLPAGSDRCSTGQFIDKLGCSRCDDACESCYGEGEGHCLTCPSPNLLEDYRCVPECSSGYYAEAGRCIRCVHGCTECVSRLNCTSCAGSLRLQSGACRTSCADGYYADRGACSKCYLSCRTCIGPRRDQCASCPQGWRLAAGECHPECPQGFYKSDDGCRHCHHYCRECSDSGPLHCTSCPPRFVLDGGLCMECLGSQYYEAGNGTCSTCDPSCRTCYGSGQFSCTGCSRPLRLDRLNNQCVPCCTDRGTTTSPGTECCHCHPETGECINSSVAGKRRIAEWGALHTVENARSTSAPSAAAITVMVCLSAGALFFVVLMILQWRSPRDKRTRTRGLVYYPLAYNDDGKVVVLAPHTAFPSSESRTEELHEHEDEPLLEHST

Summary

Description
Furin is likely to represent the ubiquitous endoprotease activity within constitutive secretory pathways and capable of cleavage at the RX(K/R)R consensus motif.
Catalytic Activity
Release of mature proteins from their proproteins by cleavage of -Arg-Xaa-Yaa-Arg-|-Zaa- bonds, where Xaa can be any amino acid and Yaa is Arg or Lys. Releases albumin, complement component C3 and von Willebrand factor from their respective precursors.
Cofactor
Ca(2+)
Similarity
Belongs to the peptidase S8 family.
Belongs to the peptidase S8 family. Furin subfamily.
Keywords
Alternative splicing   Cleavage on pair of basic residues   Complete proteome   Disulfide bond   Glycoprotein   Hydrolase   Membrane   Protease   Reference proteome   Repeat   Serine protease   Signal   Transmembrane   Transmembrane helix   Zymogen  
Feature
chain  Furin-like protease 2
splice variant  In isoform A.
EC Number
3.4.21.75
EMBL
BABH01037900    Z68888    CAA93116.1    NWSH01000051    PCG80179.1    RSAL01000033    + More
RVE51494.1    KQ459585    KPI98346.1    AGBW02010411    OWR48567.1    KQ460211    KPJ16512.1    GBXI01004172    JAD10120.1    GBXI01009632    JAD04660.1    GDHF01029508    JAI22806.1    GAMC01018483    JAB88072.1    JRES01001522    KNC22262.1    KA645434    AFP60063.1    GFDL01004017    JAV31028.1    GFDL01004015    JAV31030.1    GFDL01004012    JAV31033.1    GFDL01004014    JAV31031.1    GECZ01007763    JAS62006.1    GANO01003419    JAB56452.1    GGFL01016196    MBW80374.1    GGFM01001305    MBW22056.1    GGFL01016237    MBW80415.1    GGFK01002655    MBW35976.1    GGFJ01000508    MBW49649.1    GGFJ01000501    MBW49642.1    GGFJ01000503    MBW49644.1    GGFK01002802    MBW36123.1    GGFK01002391    MBW35712.1    GEDC01026106    JAS11192.1    ODYU01006244    SOQ47911.1    JTDY01000105    KOB78841.1    CVRI01000047    CRK97614.1    DS234995    EEB10108.1    OUUW01000015    SPP88772.1    AE014298    ACZ95309.1    CH379064    KRT06942.1    EAL32121.2    CH964239    EDW82571.2    KRT06944.1    KRT06945.1    M94375    L33831    BT021414    AY070553    KRT06943.1    CH940651    EDW65630.1    KRF82320.1    KRF82319.1    ADTU01013412    ADTU01013413    CM000162    EDX01911.1    CH954180    EDV46876.2    KRK06434.1    KRK06436.1    KRK06435.1    KRK06433.1    KQ981490    KYN41168.1    KQS30223.1    KQS30224.1    KQS30225.1    RSAL01000126    RVE46569.1    CH916370    EDW00125.1    CM000366    EDX18084.1    KQ977871    KYM99195.1    UFQT01000021    SSX17944.1    NWSH01001572    PCG70828.1    SSX17946.1    ODYU01009227    SOQ53495.1    AGBW02007756    OWR54611.1    GGFL01001478    MBW65656.1    KQ976401    KYM92418.1    KK107064    EZA60894.1    CH933815    EDW08039.1    CH902644    KPU75290.1    KRG07562.1    KRG07564.1    KRG07565.1    KRG07567.1    KRG07561.1    EDV34801.1    KRG07566.1    CP012528    ALC48584.1    GL449036    EFN83372.1    GBYB01002977    JAG72744.1    KPI98343.1    GL443146    EFN62505.1    GGFL01000782    MBW64960.1    GGFL01000777    MBW64955.1    SSX17945.1    GL888387    EGI61759.1    GBYB01003844    JAG73611.1    KQ982080    KYQ60346.1    ADMH02001671    ETN61480.1    GL762454    EFZ21411.1    KQ978625    KYN29621.1    KZ288254    PBC30823.1    NEVH01009384    PNF33201.1    AXCN02000011    KK852463    KDR23424.1    KQ435735    KOX77124.1    GFXV01006180    MBW17985.1   
Pfam
PF00082   Peptidase_S8        + More
PF14843   GF_recep_IV
PF01483   P_proprotein
PF16470   S8_pro-domain
PF15913   Furin-like_2
Interpro
IPR000209   Peptidase_S8/S53_dom        + More
IPR032778   GF_recep_IV       
IPR015500   Peptidase_S8_subtilisin-rel       
IPR006212   Furin_repeat       
IPR036852   Peptidase_S8/S53_dom_sf       
IPR008979   Galactose-bd-like_sf       
IPR022398   Peptidase_S8_His-AS       
IPR009030   Growth_fac_rcpt_cys_sf       
IPR002884   P_dom       
IPR023827   Peptidase_S8_Asp-AS       
IPR023828   Peptidase_S8_Ser-AS       
IPR034182   Kexin/furin       
IPR032815   S8_pro-domain       
IPR038466   S8_pro-domain_sf       
IPR000742   EGF-like_dom       
IPR011031   Multihaem_cyt       
SUPFAM
SSF57184   SSF57184        + More
SSF49785   SSF49785       
SSF52743   SSF52743       
Gene 3D
PDB
1P8J     E-value=1.57853e-151,     Score=1379

Ontologies

Topology

Subcellular location
Membrane  
Length:
1146
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.95659
Exp number, first 60 AAs:
9e-05
Total prob of N-in:
0.00672
outside
1  -  1063
TMhelix
1064  -  1086
inside
1087  -  1146
 
 

Population Genetic Test Statistics

Pi
213.461858
Theta
178.545172
Tajima's D
0.564621
CLR
0.414994
CSRT
0.527323633818309
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 MIDGIVNDAVEAR 100.00 5e-04
26822097 CSTGQFIDK 100.00 0.002
24402669 RDPPQVDIWPQGER 100.00 0.041
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号