SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12441
Pre Gene Modal
BGIBMGA002354
Annotation
Furin-like_protease_2_[Papilio_machaon]
Full name
Furin-like protease 2      
Location in the cell
Extracellular   Reliability : 3.664
 

Sequence

CDS
ATGAGGCAATCTAGCGCACCGTCTTTTCCTGATCCACTGTTCAAAGAGCAGTGGTATTTGAATGGTGGCGCAGCTGATGGTCTCGATATGAATGTCGGGTATGCTTGGAGGAAGGGCTATACGGGGAAAGGTGTCGTCATTACTATACTCGATGATGGCATACAGCCTAATCACCCGGATCTATCACAGAATTACGATCCGGCCGCTTCAACTGACATAAACGGGAACGATACGGACCCGACACCACAGGACAATGGCGACAATAAACACGGGACCCGTTGTGCAGGAGAGGTAGCTGCCGTCGCTTATAACCGATACTGTGGCGTTGGTATAGCATACAATGCTAGCATTGGAGGAGTGAGAATGCTGGATGGCGTTGTAAACGACGCAGTGGAAGCTCAAGCACTCGGATTTAACACGCATCATATTGATATATATAGTGCGTCGTGGGGACCGGAGGACGACGGAAAAACTGTCGACGGCCCGGGTCCTTTAGCTCGAAGAGCGTTTATCAACGGAGTAACGAACGGAAGAGGGGGAAAAGGATCCATATTCATATGGGCATCAGGAAACGGGGGGCGGCACACTGACTCTTGTAACTGCGACGGGTATGCTAATAGCATATTCACTATATCCATATCTAGCGCAACGCAAGGAGGGTACAAGCCTTGGTATTTAGAAGAATGCTCTTCGACTTTAGCTTCAACGTATAGTTCAGGTACACCAGGACGAGATAAAAGCGTTGCAACCGTTGATATGGACGTCCAATTACGAGCGGAGCATATCTGCACGGTCGACCATACGGGTACCTCAGCATCCGCACCATTGGCTGCAGGAATTTGTGCATTAGCTTTAGAAGCTAATCCGCTATTGTCGTGGAGAGATATGCAGCATTTAATTGTAATGACGTCACGTTCTCAACCCCTAGAAAAAGAAGAAGGGTGGATCGTGAATGGTGTTAAAAGAAAAGTTAGTCATAAATTCGGTTACGGACTGATGGATGCAGCTCAAATGGTCAATCTAGCTGAGCAGTGGACTAATGTGGCGCCTCAGCACATTTGTAAATCCCAAGAAATAAACGAAGACAAATCCATTGAAACGTCTTTCGGTTATACGATATCTGTACACATGGACGTGAATGGGTGCAGCGGGACGACAAACGAGGTCAGATTTTTGGAACACGTTCAATGTAAAATTTCGTTAAGCTTTTTTCCGAGAGGTAATTTACGAATATTGCTTACATCACCGATGGGAACCACATCTACGCTTCTATTCGAAAGGACCCATGACGCAATTAGTTCGAATTTCGACGACTGGCCGTTTTTGAGCGTTCATTTCTGGGGTGAAAACGCCGAAGGGAGATGGACTTTGCAAATTATAAATGCGGGCAATACTCACGCGACGCAAGCTGGAGTATTGAAGAAATGGCAATTATTTTTTTACGGTACCGCTGTCTCCCCCATACGGCTACGAAATAAAGACTATATGAACTCGAAAAATTCGTACCACGAAGAAAAAACATATCACATTAATGACGTATACGATGCATCTGAATACTCTCAGTTTTTAAACGAAATTGAACTAGGTATTTCAGACAGGCGTAGCTACGAGAAAAACATTCCATCGGCTCAAAGAAAGAATGTTTTAGCGGATGCTAATGATAAGCAAGTGCAGAGACTATGCGATCCGGAATGTGATTCGCAGGGCTGCTACGGCAAAGGCCCAACGCAGTGTGTCGCTTGTAAACATTACCGTTTGGATAATTCATGTGTTTCAAAATGCCCCCCCAGGAGTTTTGTTAATCAAGGCGGAGTCTGCTGGCCATGTCACGAGTCTTGTGAAACGTGTGCCGGAGCCGGACAAGATTCATGTTTGACTTGCGCGCCGGCACATTTACTGGTCGTGGATTTGGCTGTCTGCCTGCAGCAGTGCCCAGATGGTTACTATGAAGACCCAGATGCCAACGCATGTTTTCCATGCGCCGAACATTGTGATACATGCACAGAGAAAGCAGACTTGTGTTCTTCTTGTGCCCACAGTTATGTTTTGTACAATGGATCTTGTTTAGCGGCCTGTCCACCAAGTACTTATCAAAAAGACTACTATGGCTGTATGCCATGTCACGAATCTTGTGACTCTTGTTACGGACCGAGCCAAAATTCTTGCGTGTCCTGTAAAATTGGAGACTTTGTCTTCAAGAACCAATGTATTTCGAAGTGTCCTTCAGGCTTCTATGCGGATTCGCAGAAAAGGGAATGCTTAGAGTGTCCGATTGGATGTTTGGTATGCTCTTATGGAGTGTGTTCTTCCTGTAAAGAGGAGTGGACGCTCACTAAGGGAGGAAGTTGCTTTCCCGATGGAAACGAAAAATGTGATACAAATGAATATTACGAGGGAGGTCGATGCAAAAATTGCCATTCAACATGCGAGAAATGTAGCGGACCGAACGAGTGGGATTGCATCTCTTGTTCAAGTCCTCTTCTGTTACAAGGGTCGAGGTGTGTGGCAGAATGTGGACGCGGGTATTATCAAACCGCCGGGTCTGGACCAACAAGTTGTGTTACTTGCGCTCATCCACTTCAATTAGATAGAGTCAACTACAAATGTTTACCTTGCTGCTTAGAAAATATGGCATCTATTTACTTAACAGTCAATGAAACATCAGATTGTTGCCATTGTGATAAGGATATCGGGGGGTGCTTAAATGGTTCATCGGCTGGTAAAAGAAGAATAGCTGAAAATATAAGGACACATATTACTGCATCATATTTCATAGAGGATTCGAAGGATTCTGCAGATACCATCGATTTAAACTATGTTATCATTTGGAGTGCGGCAGCTACTGTTATTGTGATTGTCATAATCGACAGAAATTTATCTGATATTTCATAA
Protein
MRQSSAPSFPDPLFKEQWYLNGGAADGLDMNVGYAWRKGYTGKGVVITILDDGIQPNHPDLSQNYDPAASTDINGNDTDPTPQDNGDNKHGTRCAGEVAAVAYNRYCGVGIAYNASIGGVRMLDGVVNDAVEAQALGFNTHHIDIYSASWGPEDDGKTVDGPGPLARRAFINGVTNGRGGKGSIFIWASGNGGRHTDSCNCDGYANSIFTISISSATQGGYKPWYLEECSSTLASTYSSGTPGRDKSVATVDMDVQLRAEHICTVDHTGTSASAPLAAGICALALEANPLLSWRDMQHLIVMTSRSQPLEKEEGWIVNGVKRKVSHKFGYGLMDAAQMVNLAEQWTNVAPQHICKSQEINEDKSIETSFGYTISVHMDVNGCSGTTNEVRFLEHVQCKISLSFFPRGNLRILLTSPMGTTSTLLFERTHDAISSNFDDWPFLSVHFWGENAEGRWTLQIINAGNTHATQAGVLKKWQLFFYGTAVSPIRLRNKDYMNSKNSYHEEKTYHINDVYDASEYSQFLNEIELGISDRRSYEKNIPSAQRKNVLADANDKQVQRLCDPECDSQGCYGKGPTQCVACKHYRLDNSCVSKCPPRSFVNQGGVCWPCHESCETCAGAGQDSCLTCAPAHLLVVDLAVCLQQCPDGYYEDPDANACFPCAEHCDTCTEKADLCSSCAHSYVLYNGSCLAACPPSTYQKDYYGCMPCHESCDSCYGPSQNSCVSCKIGDFVFKNQCISKCPSGFYADSQKRECLECPIGCLVCSYGVCSSCKEEWTLTKGGSCFPDGNEKCDTNEYYEGGRCKNCHSTCEKCSGPNEWDCISCSSPLLLQGSRCVAECGRGYYQTAGSGPTSCVTCAHPLQLDRVNYKCLPCCLENMASIYLTVNETSDCCHCDKDIGGCLNGSSAGKRRIAENIRTHITASYFIEDSKDSADTIDLNYVIIWSAAATVIVIVIIDRNLSDIS

Summary

Description
Furin is likely to represent the ubiquitous endoprotease activity within constitutive secretory pathways and capable of cleavage at the RX(K/R)R consensus motif.
Catalytic Activity
Release of mature proteins from their proproteins by cleavage of -Arg-Xaa-Yaa-Arg-|-Zaa- bonds, where Xaa can be any amino acid and Yaa is Arg or Lys. Releases albumin, complement component C3 and von Willebrand factor from their respective precursors.
Cofactor
Ca(2+)
Similarity
Belongs to the peptidase S8 family.
Belongs to the peptidase S8 family. Furin subfamily.
Keywords
Alternative splicing   Cleavage on pair of basic residues   Complete proteome   Disulfide bond   Glycoprotein   Hydrolase   Membrane   Protease   Reference proteome   Repeat   Serine protease   Signal   Transmembrane   Transmembrane helix   Zymogen  
Feature
chain  Furin-like protease 2
splice variant  In isoform A.
EC Number
3.4.21.75
EMBL
BABH01037938    KQ460211    KPJ16515.1    NWSH01001572    PCG70828.1    ODYU01009227    + More
SOQ53495.1    RSAL01000126    RVE46569.1    AGBW02007756    OWR54611.1    KQ459585    KPI98343.1    JTDY01000441    KOB77156.1    NWSH01000051    PCG80179.1    AGBW02010411    OWR48567.1    Z68888    CAA93116.1    RSAL01000033    RVE51494.1    KPJ16512.1    KPI98346.1    ODYU01006244    SOQ47911.1    BABH01037900    GBXI01004172    JAD10120.1    GDHF01029508    JAI22806.1    GBXI01009632    JAD04660.1    JTDY01000105    KOB78841.1    GAMC01018483    JAB88072.1    GFDL01004014    JAV31031.1    GFDL01004017    JAV31028.1    GFDL01004015    JAV31030.1    GFDL01004012    JAV31033.1    KA645434    AFP60063.1    JRES01001522    KNC22262.1    GGFL01016196    MBW80374.1    GGFM01001305    MBW22056.1    GGFK01002655    MBW35976.1    GGFL01016237    MBW80415.1    GGFK01002802    MBW36123.1    GGFK01002391    MBW35712.1    GGFJ01000501    MBW49642.1    GGFJ01000503    MBW49644.1    GGFL01001478    MBW65656.1    GGFJ01000508    MBW49649.1    AY555267    AAT37510.1    GAPW01000047    JAC13551.1    GANO01003419    JAB56452.1    UFQT01000021    SSX17946.1    SSX17944.1    KQ981490    KYN41168.1    GECZ01007763    JAS62006.1    KQ976401    KYM92418.1    GEDC01026106    JAS11192.1    ADTU01013412    ADTU01013413    GEZM01082529    JAV61340.1    KQ971311    KYB29424.1    CVRI01000047    CRK97614.1    GBYB01003844    JAG73611.1    KQ977871    KYM99195.1    GBYB01002977    JAG72744.1    SSX17945.1    GL449036    EFN83372.1    CH940651    KRF82319.1    EDW65630.1    KRF82320.1    OUUW01000015    SPP88772.1    CM000162    KRK06433.1    CH933815    EDW08039.1    CH379064    KRT06943.1    EDX01911.1    CH954180    EDV46876.2    EAL32121.2    KQS30224.1    KQS30225.1    CP012528    ALC48584.1    KY407546    ATU47252.1    KRK06435.1    KRG07562.1    KRG07564.1    KRG07565.1    KRG07567.1    CH964239    EDW82571.2    KRT06944.1    KRT06945.1    DS234995    EEB10108.1    KRK06434.1    KRK06436.1    KRG07561.1    AE014298    ACZ95309.1    KRT06942.1    KRG07566.1    M94375    L33831    BT021414    AY070553    KQS30223.1    CH916370    EDW00125.1    CH902644    EDV34801.1    CM000366    EDX18084.1    KPU75290.1    GL888387    EGI61759.1    AAAB01008859    KQ978625    KYN29621.1    KZ288254    PBC30823.1    KQ982080    KYQ60346.1    GFXV01006180    MBW17985.1    KK107064    EZA60894.1    ATLV01012931    ATLV01012932    ATLV01012933    ATLV01012934    ATLV01012935    ATLV01012936    ATLV01012937    ATLV01012938    KE524827    KFB37072.1    ABLF02040171    ABLF02040188    ABLF02040191   
Pfam
PF01483   P_proprotein        + More
PF14843   GF_recep_IV
PF00082   Peptidase_S8
PF16470   S8_pro-domain
PF15913   Furin-like_2
Interpro
IPR034182   Kexin/furin        + More
IPR023828   Peptidase_S8_Ser-AS       
IPR022398   Peptidase_S8_His-AS       
IPR002884   P_dom       
IPR023827   Peptidase_S8_Asp-AS       
IPR009030   Growth_fac_rcpt_cys_sf       
IPR006212   Furin_repeat       
IPR036852   Peptidase_S8/S53_dom_sf       
IPR008979   Galactose-bd-like_sf       
IPR015500   Peptidase_S8_subtilisin-rel       
IPR000209   Peptidase_S8/S53_dom       
IPR032778   GF_recep_IV       
IPR038466   S8_pro-domain_sf       
IPR032815   S8_pro-domain       
IPR000742   EGF-like_dom       
IPR011031   Multihaem_cyt       
SUPFAM
SSF52743   SSF52743        + More
SSF49785   SSF49785       
SSF57184   SSF57184       
Gene 3D
PDB
1P8J     E-value=1.3192e-152,     Score=1388

Ontologies

Topology

Subcellular location
Membrane  
Length:
963
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
11.75856
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.00118
outside
1  -  963
 
 

Population Genetic Test Statistics

Pi
185.508713
Theta
166.357344
Tajima's D
0.06608
CLR
13.924643
CSRT
0.392930353482326
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号