SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12430
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Diaphorina_citri]
Full name
Secretory carrier-associated membrane protein      
Location in the cell
Cytoplasmic   Reliability : 2.114
 

Sequence

CDS
ATGAATGAGGAGAACGACTGGAATAGAGTGATTAATAGGAAGCCAGAGAACGTCGGACTTGTGAATGAGATTAGTATGTATGAAGTTAGAGAAGCAGTGAGAAGTATGAAAAGCGGAAAATCGGAAGGACCAGACGGTATACCAGTGGAAGTATGGAAGATACTGGGAGAAGACGGATATAAGTGGCTGACTTTATTCTTCAATAAGCTGCTGCAAGAAGAAGTGATCCCTACGGAATGGAGCATCAGTACGCTGGTGCCCATATACAAAAATAAAGGGGATGTGCAAGACTGTGGCAGCTATCGGGGAATAAAGCTTATGTCTCATAGTATGAAAGTTTGGGAGAAAGTGATAGAAAAGCGATTGCGAGATGAAAGTGAGATCACCCAAAACCAGTTCGGGTTCATGCCTGGTCGCGGGACAACGGACGCCATATTTGCACTCCGCCAAGTGTGCGAAAAACATCGCGACATGCACAGGAATCTACATATGGTGTTCGTTGATCTAGAGAAAGCGTACGACCGAGTACCTAGAGCAGTTTTGTGGTGGGCATTGAATGAGAAAGGTATACCTGGTAAGTATGTGAGGTTAATCTGTGCCATGCACAGTCGAGCCAGGACGTATGTACGAACCGCCGCGGGGAATTCCGACGAGTTCAATGTGGCAGTGGGCTTACACCAAGGGTCTGCACTAAGTCCCTATCTCTTCCTGCTTGTGATGGATGCCTTGACATCGGAGATACAGGAAGAGCCCCCTTGGTGTATGCTGTTTGCCGATGACATAGTGCTCGTCGGAGAAAACGGGCTCGAGGTCCAAAACATACTGGAGAAATGGCGATGCAAGTTGGAGAGTGTTGACCTAAAAATCAGCAGATCGAAAACCGAACATCTGTTCTGTGATTTTGGCGGTCTCTCCAATTTTGCACCCATTTCCCTCGACGGAACACCTTTGCCAGTATGTCAAGACTTCCGCTACCTAGGGTCTGTTATCCAAAGCGACGGTGAACTGGATCGTACTGTCAGGCACAGAATTGACGCAGGATGGATGAAATGGCGGCAGGTCACGGGCACCATATGTGACTCGCACATCCCTCTTCCCCTAAAAGGGAAGATATATAAGACCTTAATAAGGCCTGCCGTCTTGTATGGATCAGCGTGTTGGACAACGAAAGTGGCGGATGAAAGGCGATTGCATGCAGCAGAGATGCGAATGTTGCGATGGATGTGTGGAGTAACGAGAATGGATAGAATACGGAATGAATATGTTAGAGGAAGTCTGAAAGTGGCACCTGTGACAGAGAAGCTGAGGAGTGCACGTTTGGGATGGTATGGACATGTGATGAGACGGAATGAAAATGAGGTTGTTAAGAGAGTGTTAACTATGAATGTGGAAGGATTTAGAGGAAGAGGTAGACCTAAGAAGAAATGA
Protein
MNEENDWNRVINRKPENVGLVNEISMYEVREAVRSMKSGKSEGPDGIPVEVWKILGEDGYKWLTLFFNKLLQEEVIPTEWSISTLVPIYKNKGDVQDCGSYRGIKLMSHSMKVWEKVIEKRLRDESEITQNQFGFMPGRGTTDAIFALRQVCEKHRDMHRNLHMVFVDLEKAYDRVPRAVLWWALNEKGIPGKYVRLICAMHSRARTYVRTAAGNSDEFNVAVGLHQGSALSPYLFLLVMDALTSEIQEEPPWCMLFADDIVLVGENGLEVQNILEKWRCKLESVDLKISRSKTEHLFCDFGGLSNFAPISLDGTPLPVCQDFRYLGSVIQSDGELDRTVRHRIDAGWMKWRQVTGTICDSHIPLPLKGKIYKTLIRPAVLYGSACWTTKVADERRLHAAEMRMLRWMCGVTRMDRIRNEYVRGSLKVAPVTEKLRSARLGWYGHVMRRNENEVVKRVLTMNVEGFRGRGRPKKK

Summary

Description
Probably involved in membrane trafficking.
Similarity
Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family.
Belongs to the ubiquitin-conjugating enzyme family.
Belongs to the SCAMP family.
Uniprot
A0A2A4IZ11   A0A1D6FKL2   A0A1D6FKL0   A0A1D6JF34   A0A317Y9W4   A0A1D6G0V4   + More
A0A1D6Q028   A0A1D6LAQ1   A0A445I4A2   A0A1D6IMH2   A0A3L6E1R1   A0A1D6FKM0   A0A3L6DEY6   A0A1D6K060   A0A151QVZ1   A0A445KIE6   A0A1D6JIM9   A0A1D6L213   A0A445F1L6   A0A1D6FKK2   A0A1D6KX85   A0A317Y223   A0A1D6GGM3   A0A1D6MK44   A0A1D6KG90   A0A445FHJ6   A0A1D6I601   A0A1D6H1V1   A0A1D6M7A6   A0A1D6P0V1   A0A1D6PU65   A0A317Y8S7   A0A1D6MYV7   A0A3L6FLU6   A0A445G8Y2   A0A445LSA6   A0A1D6NCE0   A0A1D6HX90   A0A1D6JJN9   A0A445F014   A0A1D6FKM1   A0A1D6FJU8   A0A445IZH0   A0A1D6J5H5   A0A1D6LXZ4   A0A1D6H871   A0A3L6FHK1   A0A1D6KLY6   A0A1D6I7A1   A0A1D6JQ10   A0A3L6FAM2   A0A1D6K3M7   A0A1D6LFI2   A0A445GG92   A0A1D6I351   A0A1D6LC02   A0A445LEB4   A0A1D6KVT7   A0A3L6EF28   A0A1D6KWI6   A0A445J0R5   A0A3L6DTJ3   A0A1D6G503   A0A445G8F3   A0A445JKB6   A0A1D6I607   A0A445G0L4   A0A445JXN6   A0A1D6MV72   A0A445FDA8   A0A445I5C8   A0A317YB76   A0A3L6G913   A0A445IKK3   A0A445FAX2   A0A3L6GA57   A0A445FE86   A0A1D6GRX4   A0A445I5E3   A0A445FED8   A0A1D6HE72   A0A445FNJ6   A0A445GQC7   A0A445I5D1   A0A1D6LGC8   A0A3L6EGE5   A0A3P9IMA9   A0A1U8GZ26   A0A3B3HQB6   A0A2I0WG66   A0A3B3HS69   A0A3P9H8X2   A0A2I0VMH1   A0A3B3I8S7   A0A3P9K727   A0A3P9JDN6   A0A3B3IEV4   A0A3B3IM62   A0A3B3H692   A0A3B3IFA0  
EMBL
NWSH01004369    PCG65177.1    CM000784    AQK92235.1    AQK92238.1    CM000786    + More
AQK46390.1    NCVQ01000001    PWZ55478.1    AQK97087.1    CM000780    AQK52011.1    CM007647    ONM11203.1    QZWG01000011    RZB80887.1    CM007650    ONM60488.1    NCVQ01000008    PWZ14448.1    AQK92237.1    NCVQ01000010    PWZ06717.1    ONL97201.1    KQ484600    KYP34423.1    QZWG01000005    RZC10711.1    AQK47447.1    ONM08550.1    QZWG01000020    RZB42640.1    AQK92248.1    ONM07070.1    PWZ52216.1    CM000781    AQK62698.1    CM007649    ONM29620.1    ONM02098.1    QZWG01000019    RZB48314.1    RZB48315.1    RZB48316.1    ONM55518.1    AQK68857.1    CM000782    AQK86945.1    CM000785    AQL03708.1    AQK50169.1    PWZ54893.1    ONM33873.1    NCVQ01000004    PWZ33800.1    QZWG01000017    RZB57624.1    QZWG01000002    RZC26146.1    ONM38170.1    ONM52836.1    ONL92524.1    RZB42155.1    AQK92256.1    AQK92036.1    QZWG01000009    RZB91510.1    RZB91511.1    AQK43188.1    AQK84025.1    AQK70926.1    PWZ32579.1    ONM03863.1    ONM55942.1    AQK59578.1    ONL94081.1    ONM09892.1    ONM36701.1    PWZ29990.1    AQK53188.1    ONL98233.1    AQK78701.1    QZWG01000016    RZB60259.1    ONM54584.1    ONM11626.1    QZWG01000003    RZC21519.1    ONM06616.1    NCVQ01000007    PWZ18651.1    ONM06831.1    RZB91994.1    NCVQ01000009    PWZ11925.1    AQK98364.1    RZB57475.1    QZWG01000008    RZB98883.1    ONM55524.1    RZB54740.1    QZWG01000007    RZC03247.1    ONM32720.1    RZB46832.1    RZB81213.1    PWZ54982.1    NCVQ01000002    PWZ44991.1    QZWG01000010    RZB86608.1    RZB45971.1    PWZ45158.1    RZB47165.1    AQK65817.1    RZB81212.1    RZB47164.1    AQK72949.1    QZWG01000018    RZB50463.1    QZWG01000015    RZB63470.1    RZB81211.1    AQK78972.1    NCVQ01000006    PWZ20114.1    KZ502668    PKU74657.1    KZ503407    PKU64612.1   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF00083   Sugar_tr
PF00179   UQ_con
PF01300   Sua5_yciO_yrdC
PF05608   DUF778
PF13716   CRAL_TRIO_2
PF14529   Exo_endo_phos_2
PF04832   SOUL
PF01501   Glyco_transf_8
PF00226   DnaJ
PF01248   Ribosomal_L7Ae
PF01738   DLH
PF03328   HpcH_HpaI
PF04937   DUF659
PF14372   DUF4413
PF05699   Dimer_Tnp_hAT
PF00098   zf-CCHC
PF13632   Glyco_trans_2_3
PF00005   ABC_tran
PF04144   SCAMP
PF08555   DUF1754
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR005828   MFS_sugar_transport-like       
IPR029006   ADF-H/Gelsolin-like_dom_sf       
IPR003663   Sugar/inositol_transpt       
IPR005829   Sugar_transporter_CS       
IPR036259   MFS_trans_sf       
IPR020846   MFS_dom       
IPR000608   UBQ-conjugat_E2       
IPR016135   UBQ-conjugating_enzyme/RWD       
IPR023313   UBQ-conjugating_AS       
IPR017945   DHBP_synth_RibB-like_a/b_dom       
IPR006070   YrdC-like_dom       
IPR036882   Alba-like_dom_sf       
IPR027124   Swc5/CFDP2       
IPR008496   TMEM222/RTE1       
IPR001251   CRAL-TRIO_dom       
IPR036865   CRAL-TRIO_dom_sf       
IPR011256   Reg_factor_effector_dom_sf       
IPR006917   SOUL_haem-bd       
IPR002495   Glyco_trans_8       
IPR029044   Nucleotide-diphossugar_trans       
IPR036869   J_dom_sf       
IPR018253   DnaJ_domain_CS       
IPR001623   DnaJ_domain       
IPR029064   L30e-like       
IPR004038   Ribosomal_L7Ae/L30e/S12e/Gad45       
IPR002925   Dienelactn_hydro       
IPR029058   AB_hydrolase       
IPR015813   Pyrv/PenolPyrv_Kinase-like_dom       
IPR005000   Aldolase/citrate-lyase_domain       
IPR040442   Pyrv_Kinase-like_dom_sf       
IPR027417   P-loop_NTPase       
IPR007021   DUF659       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR025525   hAT-like_transposase_RNase-H       
IPR001173   Glyco_trans_2-like       
IPR036398   CA_dom_sf       
IPR003439   ABC_transporter-like       
IPR036565   Mur-like_cat_sf       
IPR001645   Folylpolyglutamate_synth       
IPR018109   Folylpolyglutamate_synth_CS       
IPR036615   Mur_ligase_C_dom_sf       
IPR007273   SCAMP       
IPR013865   FAM32A       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219        + More
SSF103473   SSF103473       
SSF54495   SSF54495       
SSF55821   SSF55821       
SSF82704   SSF82704       
SSF52087   SSF52087       
SSF55136   SSF55136       
SSF53448   SSF53448       
SSF46565   SSF46565       
SSF55315   SSF55315       
SSF53474   SSF53474       
SSF51621   SSF51621       
SSF52540   SSF52540       
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF51069   SSF51069       
SSF53623   SSF53623       
SSF53244   SSF53244       
ProteinModelPortal
A0A2A4IZ11   A0A1D6FKL2   A0A1D6FKL0   A0A1D6JF34   A0A317Y9W4   A0A1D6G0V4   + More
A0A1D6Q028   A0A1D6LAQ1   A0A445I4A2   A0A1D6IMH2   A0A3L6E1R1   A0A1D6FKM0   A0A3L6DEY6   A0A1D6K060   A0A151QVZ1   A0A445KIE6   A0A1D6JIM9   A0A1D6L213   A0A445F1L6   A0A1D6FKK2   A0A1D6KX85   A0A317Y223   A0A1D6GGM3   A0A1D6MK44   A0A1D6KG90   A0A445FHJ6   A0A1D6I601   A0A1D6H1V1   A0A1D6M7A6   A0A1D6P0V1   A0A1D6PU65   A0A317Y8S7   A0A1D6MYV7   A0A3L6FLU6   A0A445G8Y2   A0A445LSA6   A0A1D6NCE0   A0A1D6HX90   A0A1D6JJN9   A0A445F014   A0A1D6FKM1   A0A1D6FJU8   A0A445IZH0   A0A1D6J5H5   A0A1D6LXZ4   A0A1D6H871   A0A3L6FHK1   A0A1D6KLY6   A0A1D6I7A1   A0A1D6JQ10   A0A3L6FAM2   A0A1D6K3M7   A0A1D6LFI2   A0A445GG92   A0A1D6I351   A0A1D6LC02   A0A445LEB4   A0A1D6KVT7   A0A3L6EF28   A0A1D6KWI6   A0A445J0R5   A0A3L6DTJ3   A0A1D6G503   A0A445G8F3   A0A445JKB6   A0A1D6I607   A0A445G0L4   A0A445JXN6   A0A1D6MV72   A0A445FDA8   A0A445I5C8   A0A317YB76   A0A3L6G913   A0A445IKK3   A0A445FAX2   A0A3L6GA57   A0A445FE86   A0A1D6GRX4   A0A445I5E3   A0A445FED8   A0A1D6HE72   A0A445FNJ6   A0A445GQC7   A0A445I5D1   A0A1D6LGC8   A0A3L6EGE5   A0A3P9IMA9   A0A1U8GZ26   A0A3B3HQB6   A0A2I0WG66   A0A3B3HS69   A0A3P9H8X2   A0A2I0VMH1   A0A3B3I8S7   A0A3P9K727   A0A3P9JDN6   A0A3B3IEV4   A0A3B3IM62   A0A3B3H692   A0A3B3IFA0  
PDB
6AR3     E-value=0.000532142,     Score=103

Ontologies

Topology

Subcellular location
Cell membrane  
Cytoplasmic vesicle  
Secretory vesicle membrane  
Length:
475
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02443
Exp number, first 60 AAs:
0
Total prob of N-in:
0.02632
outside
1  -  475
 
 

Population Genetic Test Statistics

Pi
44.731753
Theta
56.718803
Tajima's D
1.217491
CLR
0.118024
CSRT
0.724013799310035
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号