SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12424
Annotation
PREDICTED:_uncharacterized_protein_LOC107046166_[Diachasma_alloeum]
Location in the cell
Mitochondrial   Reliability : 1.324 Nuclear   Reliability : 1.919
 

Sequence

CDS
ATGAATGGTAGCTCTGTAGTTCTGCTGGCTACTGCTAACGTTGAAGTGCGCGACTCATCTGGTCACTTTCATACTCTTCGCGCACTCATCGACCCTGGTAGTCAATCACATTTCATTTCTAATCAAGCTATGGAACGATTGGGCTTAAAGCCTAAGCAAACTTTGCGAAATGTTTGTGGCTTGGGGCAATCGTCGACGTCAGTGACTGGAATGGTGGAGCTTCAACTCGGAGTTCATCAAAAGAATTTATTTAATTTAACGGCTCTCATCTTACCATCTATTTGTGCACAAATGCCCTCTGCTCGTCTTGATCTTTCTTCATGCGAACACCTACGTAATTTGCGACTCGCTGATCCGAATTATAATAAGCCTGGACCAATAGATCTGCTTATCGGTGCTGAAATGTTTTCAACGTTGTTACTGCCCGGAAATATTTCAGGTAGTCCTCATGAACCCTCAGCCTTGAACACCATCTTCGGATGGATCCTGATGGGAAGTGTCAAATGCAGGGATGAGACAAAACACTCAAATTCTTTTTTTCTAAGAGAACACGATACTCCTCTCAATGAGGAATTGAGGAGACTGTGGGAGTTGGAGGTCATACCTAAATCATCAGTTCTAACGCCGGACCAGCAGCAATGTGAGAAACTTTTCACTGAAACCCACGCTCGAGGTACATCTGGAAGGTACATCGTTTCTTTGCCGTTTAGGCAGAGGAATGGGGAGTTACAGTTTCCGGGTTCGCGTGAAAATACATTGCGAAGATTCCATTCATTGGAACGAAGACTTCTTTCAAGTCCAAACCTTCATCAGCAGTATTCGGACTTCATGCTGGACTACTTACATAATGGTCATAGGAGTATCCTTTTATATGCTAAGTCTCGCGTGGCCCCAATTAAGAGAGTTTCATTGCCGAGACTAGAGCTCTGCGCTGCGGTTCTGCTCGCTGACCTGCTCAAATTCGTAAAAGAAGTGTATGTACCGTTACTTCCGCTTTCTGATACATTTGCTTGGTCAGATTCAACGGTAACTCTGTCAGGGATTCGTGGCCATTCCTCGCGTTGGAAAACATTTGTTGCTAATAGGGTTAGTCATATCCAAGAAACTGTCCCCGAAACTCACTGGAATCACGTGCGCTCTAATGAAAATCCTGCGGACATAGCTTCCCGCGGTATGTGTCCGAGCGACCTACTCCAGAGTGAGTTATGGTGGGCGGGACCGAACTGGCTTCGGCAACCTTCATCTTCATGGCCTTCAAATTCCGGTCTCGAGGTGAACGAGACTGATATGCTTGCCGAGGAACGCTGTTTTTCGTTGGTCGTGAATGATGAACCTAACTTTATCGATTCTTTGCTCGAAAGGTTTTCATCAATTCGTAAGGTTCAACGTATTATTGGTTATTGTCTTCGTTTTATCAGAAATGTTAACAAAAAACAGACACGTGTTCCGGGTACCTTTTTAGGTCGTGCAGAACTTCATGAGGCCCTGATGACGATTACCAAGCGAATTCAATTTCTCAACTTTCAGGATGATATTCGTAAGCTCGAGAATGGTATACCATTACCCAAACCGTGGAGAAAACTCAATCCATTCCTGGACGACCAAGGAGTTGTCAGGGTGGGCGGCCGTTTGTCTCGTTCTGGTCTTGAGTTTAGTCATAAGCATCCTGCTCTGTTGCCGCGTCATTCTAGGTTCACATACATGATCATCGAGCAATTCACAAAGAGAATTGTCATCCTGGGTTGGGAACGACACAATATCTTTTGA
Protein
MNGSSVVLLATANVEVRDSSGHFHTLRALIDPGSQSHFISNQAMERLGLKPKQTLRNVCGLGQSSTSVTGMVELQLGVHQKNLFNLTALILPSICAQMPSARLDLSSCEHLRNLRLADPNYNKPGPIDLLIGAEMFSTLLLPGNISGSPHEPSALNTIFGWILMGSVKCRDETKHSNSFFLREHDTPLNEELRRLWELEVIPKSSVLTPDQQQCEKLFTETHARGTSGRYIVSLPFRQRNGELQFPGSRENTLRRFHSLERRLLSSPNLHQQYSDFMLDYLHNGHRSILLYAKSRVAPIKRVSLPRLELCAAVLLADLLKFVKEVYVPLLPLSDTFAWSDSTVTLSGIRGHSSRWKTFVANRVSHIQETVPETHWNHVRSNENPADIASRGMCPSDLLQSELWWAGPNWLRQPSSSWPSNSGLEVNETDMLAEERCFSLVVNDEPNFIDSLLERFSSIRKVQRIIGYCLRFIRNVNKKQTRVPGTFLGRAELHEALMTITKRIQFLNFQDDIRKLENGIPLPKPWRKLNPFLDDQGVVRVGGRLSRSGLEFSHKHPALLPRHSRFTYMIIEQFTKRIVILGWERHNIF

Summary

Pfam
PF05585   DUF1758        + More
PF03564   DUF1759
PF18701   DUF5641
PF05380   Peptidase_A17
Interpro
IPR001878   Znf_CCHC        + More
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
588
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01102
Exp number, first 60 AAs:
0.00024
Total prob of N-in:
0.00067
outside
1  -  588
 
 

Population Genetic Test Statistics

Pi
331.619149
Theta
188.303069
Tajima's D
2.313109
CLR
0
CSRT
0.927253637318134
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号