SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12415
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.362 Nuclear   Reliability : 1.911
 

Sequence

CDS
ATGGACGCTGTATTCGCGGAATTCCTCCGACTTCGTCATCCACAGCTCGCCTCAGAGTTTCTGGCTTTCAAGGCCAATCACACTGCGAGCTCTCTCGAAGACTTCGCCGGGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAAAGCTTCTACATCGAGCACCGCAGCCTCCGTTGTGCCTGCCGTTCCCGCGTCGCCTATACTGGCGAGTAAAACTGCTGCGTCGTCCGCCGTGGCCACCGTTCCAGCTGTGCGATCATCCGCGGCCTCCGTCGCACCCTCCAAAACACCTGCTCGTAGGTCACCTGCGCCCGCCTCCTCGTCCTCCGACTCTGACTCGGAGATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTTACCCTGGTACAAAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCTGCGAACGCGTCGCGCCCCCGCCCCCAGACTCCCGTTGCCCGTGCCAGTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGTCCCCTCCTCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGATCGAGTTTCCCTGGCCCTTAAGGCCAAAAATATCAATTTCACGAATGCCCGTAACCTCGCGAACGGCATCCAAATAAAGGTGCATTCATCTGATGACCATAGGACCCTCACCTCTTACCTCCGTAAGGAGCGTATAAGCTTCCACACTTATACGCTTCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTAAAAGTCGACCTGTTCGAACAAGGCCTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCTCTCCAGCCTACCCCCGAGGTGCAGGAGACCCTACTTAAACCCGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCCCCTCAGGCCGACTCGCGGCCTTTGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACTCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATTTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAGCTGTATGAGCGTCTGCTCTACAAGCGCCTCAGAGATTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACAGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTATCCTTTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGAATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCACCTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGAACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MDAVFAEFLRLRHPQLASEFLAFKANHTASSLEDFAGLAAPASPVPACKASTSSTAASVVPAVPASPILASKTAASSAVATVPAVRSSAASVAPSKTPARRSPAPASSSSDSDSEMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAANASRPRPQTPVARASPSPRPVAQNKTQSPPPVILQEKAAWDRVSLALKAKNINFTNARNLANGIQIKVHSSDDHRTLTSYLRKERISFHTYTLQEERELRVVIRGIPKELDVELVKVDLFEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEVQETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPLSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIQDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSILSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNHLAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRNPGNRTRRTRQRGRRAT

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
970
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.01377000000001
Exp number, first 60 AAs:
0.0001
Total prob of N-in:
0.00107
outside
1  -  970
 
 

Population Genetic Test Statistics

Pi
2.573961
Theta
1.939358
Tajima's D
0.766827
CLR
0
CSRT
0.646667666616669
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号