SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12341
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.093
 

Sequence

CDS
ATGCCGATTGGGAAAGTTGAAAGTTTTGATATGGGATCTCAAAATTGGGACACATACATTCGTCGTGTAAAACAATTCATGGAACTCAACGACATTGAACAGAGACTTCACGTTGCAACGCTCGTGACCTTAGTTGGGTCTGAGTGCTATGACTTAATGTGTGACTTGTGTGCTCCGGACTTACCAGAAGAAAAGGATTTCGACATACTCGTAAAATTAGTCAAAGATCATCTAGAACCTGAAAGATCGGAAATAGCAGAACGTCATATCTTCAGGCAAAGAAAGCAGCAAAATAACGAAAACATTCGTTCCTACCTACAAAGTTTGAAACATTTGGCTAAAACTTGCAATTTCGGCATCACATTAGAAATTAATCTACGCGATCAATTCGTATCAGGATTATATAGTGAGGAGATGCGATCAAGGCTGTTTGCTGAAAAAGATATAGATTACAAGCGCGCTGTTGAGTTGGCATCAGCACTGGAAGCAGCGGATCGACATGCGATGGCGGCTGGGGGCACTGGGGGCAGCTCACAGGCTGCGTCCGAGAGCGAAGGCATGCATCGGGTCGGCGGAGCGCGCGCGGAGGCTCGCTGCGCCTGCAGACGCTGCGGCAAGCTGGGCCATGCGGAGGGTCGGTGTCGGTACAAGCACTACACCTGTGACTCATGTGGCGAGAAGGGACACCTAAAATCAATGTGTCGGAACCGTAAAGGTAACCAAAAGATTGAAAAAAACCGAGGTGGTGGTGAATATTACACAAAATTGGATTTATCTAATGCATTCCAGCAATGCCTCTTAGACGAAGAATCCCAGCCGATGACAGCGATCACGACACACATTGGTACTTTTGTCTATAAGCGCGTTCCGTTTGGAATTAAATGCATTCCGGAAAACTTTCAGAAGATTATGGAAGAGATTCTAAGTGTGCTGTCCGTTGACAGCAGCCAGTACGGACTGGGCGCCGTCCTCACTCAGAAGCACATCGACGGCACTGAGCGGCTCGTCAGCTGTGCCTCACGGACTCTCGCGCCAGCCGAACTTAACTATTCTCAGCTGGACAAAGAGGCTTTGGCTATAATGTTTGGGGTTACTAAACACCATCAGTATTTGTACGGGAGACGTTTTGTTTTACGAAGTGATCATAAGGCTTTGAGTTATATTCTTGGAAAGAATAAAGGTATACCTCTAACCGCCGCGAGTCGTCTGCAACGATTTGCTGTAAAGCTAGCTGCGTATGATTTTGAGATCGAATTTATTAGTTCTACAGATAATTGCCAGGCTGACGCGCTATCACGACTTCCACTCGATACTAATTTTAAGAATAATATTAAGGAGTATAATTACCTAAACTTCGTTCAAGAAAGCTTTCCACTCAGTTTTAAAGAAATTAAAAAGGAAGTTACGAAGGATCCTTTACTAAACAAAATTTATGGTTACGTCATGTTTGGCTGGCCCTCTGTCAGTAAAGAACAAGCAGAAAAACCCTATTTTAACAGAAGAGAATCCATACATATTGATCACGGTTGTCTTGTATGGGGTTACAGAATAATAATTCCAACTTCATTGCGAGAGACTGTGTTACAGGAGTTACATGAGGGACATCCGGGTATTGTTAAGATGAAACAATTAAGCCGGAACTACGTATGGTGGGAGACAGTCGATGCGGACATTGAACGTGTATGTGCTCAGTGCCAGGCCTGTCGATCTCAGCGCGCTGCACCACCATCGGTGCCGCTGCACTCGTGGCCATGGCCGGAAGAGCCGTGGGCGCGCCTTAATCTTGATTTCTTGGGACCGTTTAATAACAAATATTACTTAATTATAGTGGACGCTCATTCAAAATGGATCGAGGTGGAAAAATTGAGCTGTACATCAGCCACGGCAGTAATCGCTTGTCTCAGACGATTGTTTGCTCGATTTGGCTTAGCAAAAAAGGTAGTAACTGATAACGGACCACCTTTCTCGTCGGTCGAATTTATAACATATTTAAGTAAAAACGGTATAAAACATTTACCGGTGGCTCCGTATCATCCATCTAGCAATGGTGCAGCGGAAAACGCCGTAAAAACCATAAAAAGAGTGTTGAAAAAGGCTTTAATTGAAAAGGAAGACGACAATACCGCCTTGACAAAATTTCTCTTTATGTACAGAAATTCTGAGCACAGCACTACAGGGCGCGAACCAGCAGTTGCTTTGTTCGGACGTCGCCTGCGTGGAAGACTGGATCTGTTGCGTCCCAATACTAGCTCCATAGTACGAGAAGCACAGCTGGCAAGCGAAAGCTATAATGCAGGCACAGCCGGATATAGGGAGGCGGCAGAAGGAGACTCGGTCCTATTGCAAGATTTCACACAGGGAAAAAAGAAATGGACCACAGGAACAATAAAAAACCGCTCAGGTCCGGTGACATACAGGGTAACAGCAGATGACGGGCGGGTACACAAACGTCACATCGACCAAATTTTAATAAGTAATAATAGTCGAAAATCACGTTATTCTTTGTCAAAATTAAACACTGATTTCGAGACAAAATCAGTAAATGATAGTGTGGGTGAAGTTCGGGAAAGTCCGTGTATGACCGGAGAAAAAGAGCTCAACTCCAGCTATGACACGGGACCGGAAAGTCCACAACCTGTGACTCCTAGTCACTCGCCGGCGCCGAATGTCTTGCAACCATCGCGTCAGCGCCGTAAAGCTGCTTTAACGTGTATTCAGAGAATTAAGGACCAAAATTACTAA
Protein
MPIGKVESFDMGSQNWDTYIRRVKQFMELNDIEQRLHVATLVTLVGSECYDLMCDLCAPDLPEEKDFDILVKLVKDHLEPERSEIAERHIFRQRKQQNNENIRSYLQSLKHLAKTCNFGITLEINLRDQFVSGLYSEEMRSRLFAEKDIDYKRAVELASALEAADRHAMAAGGTGGSSQAASESEGMHRVGGARAEARCACRRCGKLGHAEGRCRYKHYTCDSCGEKGHLKSMCRNRKGNQKIEKNRGGGEYYTKLDLSNAFQQCLLDEESQPMTAITTHIGTFVYKRVPFGIKCIPENFQKIMEEILSVLSVDSSQYGLGAVLTQKHIDGTERLVSCASRTLAPAELNYSQLDKEALAIMFGVTKHHQYLYGRRFVLRSDHKALSYILGKNKGIPLTAASRLQRFAVKLAAYDFEIEFISSTDNCQADALSRLPLDTNFKNNIKEYNYLNFVQESFPLSFKEIKKEVTKDPLLNKIYGYVMFGWPSVSKEQAEKPYFNRRESIHIDHGCLVWGYRIIIPTSLRETVLQELHEGHPGIVKMKQLSRNYVWWETVDADIERVCAQCQACRSQRAAPPSVPLHSWPWPEEPWARLNLDFLGPFNNKYYLIIVDAHSKWIEVEKLSCTSATAVIACLRRLFARFGLAKKVVTDNGPPFSSVEFITYLSKNGIKHLPVAPYHPSSNGAAENAVKTIKRVLKKALIEKEDDNTALTKFLFMYRNSEHSTTGREPAVALFGRRLRGRLDLLRPNTSSIVREAQLASESYNAGTAGYREAAEGDSVLLQDFTQGKKKWTTGTIKNRSGPVTYRVTADDGRVHKRHIDQILISNNSRKSRYSLSKLNTDFETKSVNDSVGEVRESPCMTGEKELNSSYDTGPESPQPVTPSHSPAPNVLQPSRQRRKAALTCIQRIKDQNY

Summary

Uniprot
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00665   rve
Interpro
IPR001584   Integrase_cat-core        + More
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
ProteinModelPortal
PDB
4OL8     E-value=2.09852e-11,     Score=170

Ontologies

Topology

Length:
913
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00059
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00002
outside
1  -  913
 
 

Population Genetic Test Statistics

Pi
266.60495
Theta
211.275567
Tajima's D
3.010121
CLR
0.469448
CSRT
0.979851007449627
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号