SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12339
Pre Gene Modal
BGIBMGA012382
Annotation
PREDICTED:_transmembrane_and_immunoglobulin_domain-containing_protein_1-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.178
 

Sequence

CDS
ATGATTAGGCCAGAACATCTGTATATAGTTTCAGCTGCTGTTATTCAGAAGTTATGGGTTAATGATCCCGTGGGAGATGGGTCGGTGGATCTGTCCTCAGATGAGGAAGGCTTGCTGCCCCCCAAGAAATTGCCGACCACGAGGAGAGGTCGGCAGGCTTCGAGAGGAGTGAGTGCTTCACGGCCGCGGAGGAACGCACAGGGTAGGTTCGTGTGCTCCAATACTCCGGCTGCCAGCAAAGCAGATAGTGACATGGGGGTCACTACCGAGGACCCTGGTGGCGAGAGCTGTGCCTCGCTAGGGAGCTCAAAGGCGGAGATCAACGCCGCCCGAAGAGAGCAGCGCAAAGCTGTCGCGGCCGACGAAGTGTCGGAAATGGCCCGACGCGCACGCGAGCGACGCGCTACTCTAGCGGCGGAAGGGGGGGAACCATCTGCGGTGGCCCTAAGTCAGCTTGCCTTGGACGGGGTGGACTTAGTCCTGAAGGTTGCCACCAAATCCGGCAGCCTGAAGGGCACGTTTACCCGCGGTCTGAAAGAAGCTGCCGCGGACATTAAGGAGGCGATTGGCATCCTCCTCAACAGAACGGCCTCTGACGAGGTTGCGAAGTTGCAGGAGGAAAACAGCCGTCTCCGAAATGATATGGAGGACCTCCGTCGACGAGTCACTGCGTTGAGCGAGCAGCAGCAGCGGCGTACGTCCACTGATGCCGCATCGGTAGTGGCCCCGGCTCCCGCACCGAGACCGACAAGCACTCATACCGACGACGAGGTCGAGCGCATTGTCCGGCTCTGTATGCTCCAGTGCGGGAGCATGGTCAATGCTCGTATGGAGGCAATTTCTCGGCGCCTCCCTGCGGAAATCCTCCGTCCGCCACTAGCGGCCGATACACGGCGGAGGGCTGAGGAGCCGCCGAGACCTAAGCCTAGGGAGGGGAAGCCCGCCGAGGGTGTTAAAAAGCCCGTCGAGGGAGCCCCATCGAGCGATCAGCCCACGACTGCTGGGTCTAAGGGTGAGACCTGGGTTACAGTCGTGGGCCGCAAGAAGGCACGCAGGGTCGCCAAGGCGGCCTCAGCAGCAACGCACGCCCCCGGCCAAACCGCAAAGGCGGTTGCGCAGCCTGCGCGGCGGGCTGCCAAAGGCGGTCGCAAAGGACCGGCGATACGTGCTCCGCGTTCCGAAGCTGTGACGCTCACGCTACAGCCCGGAGCTGCGGAGCGCGGCGTAACGTACCAGTCGGTCATCGCCGAAGCAAAGGCCAAGATCAAATTATCAGATCTTGGTCTCCAGGCCGTCACCCACAGGCAGGCTGCCACGGGTGCACGGTTGTTCGAGGTGGCTGGTACTACGAGTGGCAGTGCCGAAAAGGCGGACGCTCTGGCCGCCAAGATGAGGGAGGTCCTCAGCCCCGAGGACGTCCGGGTCTCCAGGCCAATGAAAACCGCAGAGGTGCGGATTGCTGGCCTGGATGACTCCGTGACCTCTGAGGAGGTGGTAGCGGCCGTTGCCCGAAGTCTACTCGCAGCCACCAGCAATGGCAGCCCAGAGACCATCAGAGTCGAGCGGCCATACTTCGACGATGTGTCTCCGAGGAACGTGTCCACCGTGGTGGGACAGTCAGCAGTCTTGCGCTGCAGAGCCAAGCATATAGGGAATAGAACTGTCTCTTGGATGAGAAAACGCGACCTTCACATCCTAACCTCCCACATATTCACGTACACCGGTGACGCCAGGTTCAGCGTTCTCCATCCCGAACCTTCGGACGACTGGGACTTGAAGATCGACTACGTTCAGCCGAGAGACGCGGGGGTCTACGAGTGCCAGATCAACACTGAACCTAAAATAAACATGGCGGTGGTTTTGAACGTGGAAGCTGCTGCGGCTACCATATGGGGCTCCCAGGACGTCTACGTGAAGAAAGGGAGCACAATATCGCTGACGTGTTCGGTGAACGTCCATTCGTCGCCACCCTCCAGCGCCTCGGTCTTGTGGTAA
Protein
MIRPEHLYIVSAAVIQKLWVNDPVGDGSVDLSSDEEGLLPPKKLPTTRRGRQASRGVSASRPRRNAQGRFVCSNTPAASKADSDMGVTTEDPGGESCASLGSSKAEINAARREQRKAVAADEVSEMARRARERRATLAAEGGEPSAVALSQLALDGVDLVLKVATKSGSLKGTFTRGLKEAAADIKEAIGILLNRTASDEVAKLQEENSRLRNDMEDLRRRVTALSEQQQRRTSTDAASVVAPAPAPRPTSTHTDDEVERIVRLCMLQCGSMVNARMEAISRRLPAEILRPPLAADTRRRAEEPPRPKPREGKPAEGVKKPVEGAPSSDQPTTAGSKGETWVTVVGRKKARRVAKAASAATHAPGQTAKAVAQPARRAAKGGRKGPAIRAPRSEAVTLTLQPGAAERGVTYQSVIAEAKAKIKLSDLGLQAVTHRQAATGARLFEVAGTTSGSAEKADALAAKMREVLSPEDVRVSRPMKTAEVRIAGLDDSVTSEEVVAAVARSLLAATSNGSPETIRVERPYFDDVSPRNVSTVVGQSAVLRCRAKHIGNRTVSWMRKRDLHILTSHIFTYTGDARFSVLHPEPSDDWDLKIDYVQPRDAGVYECQINTEPKINMAVVLNVEAAAATIWGSQDVYVKKGSTISLTCSVNVHSSPPSSASVLW

Summary

Uniprot
ProteinModelPortal
PDB
6EG0     E-value=2.06975e-37,     Score=393

Ontologies

Topology

Length:
664
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0048
Exp number, first 60 AAs:
0.00172
Total prob of N-in:
0.00028
outside
1  -  664
 
 

Population Genetic Test Statistics

Pi
177.651471
Theta
189.00225
Tajima's D
0.275615
CLR
0.482628
CSRT
0.446777661116944
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号