SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12322
Annotation
PREDICTED:_uncharacterized_protein_LOC106720812_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.953
 

Sequence

CDS
ATGTCAGACGAGATAAATGAGACTTGGAGCTCGTTTCTGAAAGCCGATGCGGAGTGGCTTCCACCCGATGTGTCGTTAACCGGGCACCAGTCGGATGGGCGTCACCAATCTCCCAACATCCAGCCGTCTCGACCCTCCCCTGAAATCACCGCAGGTGTGGACAGTAACATGACAGTAACACGCGGCGAGGACTCCCCCGAACGGTCGGGCGGCGCCCTCCGACGCCTGCACTACAAGGCCACGCGCAGGGCGCATTCCGCCGCCGCCCGCCACCACAATGCTGGTACTCCACCCAAGGCTCAAAAGGCCGCCGTAGAGGCCCTCGCCCTGCGCCGACGTCTTGAGCACGAGCAGGAGCTGGCTGAACGTGAGAGGCAACGTGAAAGTCGACTGGCAGCACTCCGTCAGCAGGTAGAGGAGGGCGAACTGAAGGCCGAACTTGCCGCTCTCGACGCGGAAGCCGCGGCAAGTCACAGCAGTCGCAGTGGTTCTGCCAGGGTAAGCGTAGAAAGAACAGAAAGATGGGTACAAAGTTTAGGACAGCCAGTTTGCGTTGGCGAAAATACAGTTAATAGAGGCATCCCCGCAGTAGGGCGAGAGCAAGTAGTTGTTCCGCCTCCCGGCCACCAGGCACCTCTGCCGGCCACTGGGTCAACTGCATCCCCTGTTAACCGTTTTGTTCATCAGAAACAACTTTTAAACGTCACTAAAGCGTCCGAGACGGCCGTACTTACGCGACCGCTCATTTCCACGGAGGTTGATCAGAGTAGTCTGCTTCAGGCTGTTGCTGACACTGCAGCTGCGGCCAAGGCGCTTGCTACTTCGCACCGTCATAAACATAAGATCGAATTGTTTCCTTTCGACGGAGACGCCTTAACATGGCTACATTTCAAACGTATTTTTGATTTAACCAAAAACAATTTTTCAAATATTGAAAATATTAGTCGGTTACAAAATGCACTTCGCGGCGCGGCCCGAGATGCAGTCGCGTCACTGTTGCTGGCTACAGACAACCCGAACGACATTATAAGAGCTCTGGAGGAGAACTTCGCTCGCCCGGAAATTATAGTATTTAAGGAAGTCTCCGCTCTTAAAAATCTACCACGTTTGGGAAATGACTTGAAAGAGTTAATTACGATAACGAATAAGGTACGTAATTCTATATCTTCTTTTAAAATACTGAATCAAATTGAGTACTTGCATTCTCCAGAACTATTTCACGCCGTCTTAGGAAAATTAAACCCGGTTACTAAAGTAAGATGGACGGACTTTGCTATGCAAGATACTACAGGGCGTCCTAAATTAGAAATTATGTCCGATTTTTTGAGGCGCGAGTTAGATCAACTTATTCGGTTCGGTTTATCACCGGAATCTTGCTCGATCCAACATTCACCACAAAACACTCATCTAAACAAGCTGTATAAACGGGAAAATATTCACATAGTTACACACTCTAAACTAAATTCTAAGGCGGCGTCTACACAAAAGCTTGAATGCGCGTTTTGCAAAAAAGATCACAATATTAAGTCATGTTCTGAGTTCAAAGCCTTATCTGTTGATGAAAGGTGGGTCTGGCTGCGTGAGGTAAAAGCGTGTTATAGATGTCTTAGGCGTAGTTCACATCAGTGGAAAACATGTAAAGTTAACCCTTGTGGTGTTGATGGGTGTCTAATACGTCATCACCCGTTAATGCATGGTAAAGAACCTGTCTCTTCTGTTAATACTATGTTCGACACGCGATCCACCGAAAATGATCATACGACTAAGCACCACGAACCTGCATCTGTCGAAAAGGTAATAGTTTCTACCACTTCTACAGGTGTTCAAGAACCCAGCTCCATCTTAACTCTGTGCCCACGTGTATTTCTGAAAATCTTACCCGTTACTGTCTCTGGTCCCTCAGGAAGTTGCAATGTTTACGCACTTCTCGATGACGGTAGCACTGCTACGCTCATTGACTCAAGTATTGCTACTCAAATCGGTGCGACAGGGCCTCACCAGAAAATAACGGTTAATGGTATAGGCGGTCTCAGTAGAAACGCTACGATATCGTATGTAGATTTTCACATTAAGGGTAGGCACACACGAGACACATTTTTAGTGAAAAATGCGAGAGCTATGGAGTCTTTGTCTCTGCGTCCTCAAACGATTAGGCAGGAAACTATTGCTTCTTTCGCACATTTAGCGAATTTACCTTGCAACGTAACTTATGAAGATGCTACACCAACAGTTTTAATTGGTGCAGAGCATTGGCATTTGTCAATCAGCAGCGAGGTACGGTGTGGTGGTAAGAATGAACCCGTTGCCTGTTTAACTGCCTTAGGCTGGGTGCTTTATGGAATCGCGTCCAGTAAAACTAAATCAGTGGAGTTTGTTAATCACGGTGTGTGTATCGAACCTTCCGATGAGGAGAAATTAGACTCTTTTATTAGGGAACAATACAAAATTGATTCATTAGGTATTTCTAAAAAAGAAACTCTACATTCTAAGTCAGATAAACGTGCAGTCGAGATTTTAGAAAAAACTGCTAGACGTCTCCCCACTTCTGGTCGATTTGAGGTGGGTTTGCCGTGGCGTGACGATATACAACGCATTCCCGACAGCTACCCTCAAGCCATGTCACGATTTTTAAGTCTAGAAAGGCGCATGGCTAAAGATGCTGACTTTGCAAAAGCATATGACGTGTTCATTTCAAACATGATCGCTAAAGGCTATGCAGAAGAATGTGCTCCCGAGTCATACTACGCCAACCACATTAAAGATAAACAATCTTCTTTTATGAGGCTCTATTTACCCCATTTTGGCGTGTATCACCCTCAGAAACGTAAGCTTCGTGTAGTTCACGACGCCGCAGCCACGAATGCGGGCGTCAGCCTAAACTCTTTGTTGCTACCTGGTCCAGACCTGCTTCAGTCCTTGTTAGGTATTTTACTTCGGTTTCGCGAGGGCCGTATTGCTCTCACTGCTGATATCCGGGAAATGTTCCCTCAAGTAAGGATCAGAGAGCAAGATAGGGACGCCCTCCGGTTTCTCTGGAGGTCAAGCAGAGACCAACCTATAAAGGAGTTTAGGATGACAGCCATCATTTTCGGTGCGTGCTGCAGTCCATTTATAGCGCAATTTATTAAAAATAAAAACGCTCGTGAGCACGAAAGTTTATTTCCTAAAGCAGCTCATGCTATTTTGTACAATCATTATATGGACGATTATATTGACTCTCTCGATGACATTCAAGAGGCAGCACAACTGGCGGCAGATATTGTTGCCGTTCACAATGATGCCTACTTCGAGATGCGGGGCTGGATTTCCAACGATCCATCAGCGCTAAAATTTATTCCTGCTGATCTTAGGGCCACTCAACCGTCGTTGGAAATCAACCTGGCAGCTGCTCTGCAAGCAATATTAGAGCGTTGGGAGTATTGTGGAATCCCATAA
Protein
MSDEINETWSSFLKADAEWLPPDVSLTGHQSDGRHQSPNIQPSRPSPEITAGVDSNMTVTRGEDSPERSGGALRRLHYKATRRAHSAAARHHNAGTPPKAQKAAVEALALRRRLEHEQELAERERQRESRLAALRQQVEEGELKAELAALDAEAAASHSSRSGSARVSVERTERWVQSLGQPVCVGENTVNRGIPAVGREQVVVPPPGHQAPLPATGSTASPVNRFVHQKQLLNVTKASETAVLTRPLISTEVDQSSLLQAVADTAAAAKALATSHRHKHKIELFPFDGDALTWLHFKRIFDLTKNNFSNIENISRLQNALRGAARDAVASLLLATDNPNDIIRALEENFARPEIIVFKEVSALKNLPRLGNDLKELITITNKVRNSISSFKILNQIEYLHSPELFHAVLGKLNPVTKVRWTDFAMQDTTGRPKLEIMSDFLRRELDQLIRFGLSPESCSIQHSPQNTHLNKLYKRENIHIVTHSKLNSKAASTQKLECAFCKKDHNIKSCSEFKALSVDERWVWLREVKACYRCLRRSSHQWKTCKVNPCGVDGCLIRHHPLMHGKEPVSSVNTMFDTRSTENDHTTKHHEPASVEKVIVSTTSTGVQEPSSILTLCPRVFLKILPVTVSGPSGSCNVYALLDDGSTATLIDSSIATQIGATGPHQKITVNGIGGLSRNATISYVDFHIKGRHTRDTFLVKNARAMESLSLRPQTIRQETIASFAHLANLPCNVTYEDATPTVLIGAEHWHLSISSEVRCGGKNEPVACLTALGWVLYGIASSKTKSVEFVNHGVCIEPSDEEKLDSFIREQYKIDSLGISKKETLHSKSDKRAVEILEKTARRLPTSGRFEVGLPWRDDIQRIPDSYPQAMSRFLSLERRMAKDADFAKAYDVFISNMIAKGYAEECAPESYYANHIKDKQSSFMRLYLPHFGVYHPQKRKLRVVHDAAATNAGVSLNSLLLPGPDLLQSLLGILLRFREGRIALTADIREMFPQVRIREQDRDALRFLWRSSRDQPIKEFRMTAIIFGACCSPFIAQFIKNKNAREHESLFPKAAHAILYNHYMDDYIDSLDDIQEAAQLAADIVAVHNDAYFEMRGWISNDPSALKFIPADLRATQPSLEINLAAALQAILERWEYCGIP

Summary

EMBL
RSAL01000375    RVE42106.1    NWSH01005440    PCG64209.1    AF530470    AAQ09229.1    + More
L09635    AAA75005.1    JXUM01136032    KQ568367    KXJ69026.1    LNIX01000019    OXA44855.1    GEZM01052588    GEZM01052587    GEZM01052586    JAV74402.1    LNIX01000015    OXA46575.1    JXUM01111221    KQ565482    KXJ70922.1    GGFK01002635    MBW35956.1    GGFK01002641    MBW35962.1    GGFK01002609    MBW35930.1    LNIX01000007    OXA52015.1    GGFK01002619    MBW35940.1    LNIX01000004    OXA55241.1    GGFK01002631    MBW35952.1    OXA44537.1    GGFJ01000302    MBW49443.1    GGFJ01000218    MBW49359.1    GEHC01000967    JAV46678.1    GGFL01001682    MBW65860.1    OXA55408.1    GGFK01009497    MBW42818.1    LNIX01000003    OXA57597.1    GEHC01000872    JAV46773.1    GEHC01000956    JAV46689.1    GGFL01001842    MBW66020.1    JXUM01127084    KQ567147    KXJ69602.1    GAMC01017930    JAB88625.1    GEHC01000947    JAV46698.1    GEHC01000945    JAV46700.1    LNIX01000039    OXA39294.1    LN877231    CTR11689.1    GGFK01008809    MBW42130.1    D83207    BAA57030.1    AB110069    BAD01589.1    BAD01590.1    GGFL01001727    MBW65905.1    JXUM01034199    KQ561015    KXJ80028.1    GGFL01005193    MBW69371.1    JXUM01005879    KQ560203    KXJ83865.1    GGFM01003133    MBW23884.1    GDUN01000090    JAN95829.1    GGFJ01000432    MBW49573.1    GGFJ01000935    MBW50076.1    GGFJ01000306    MBW49447.1    GGFJ01000402    MBW49543.1    GEHC01000955    JAV46690.1    GGFJ01000487    MBW49628.1    GGFJ01000471    MBW49612.1    GGFJ01000470    MBW49611.1    ADMH02001934    ETN60411.1    GGFJ01000401    MBW49542.1    GGFJ01000333    MBW49474.1    NIRI01002071    RJW63586.1    JYDP01000296    KRZ01365.1    KL367480    KFD71819.1    JYDO01000040    KRZ75306.1    KRZ75294.1    JXUM01130316    KQ567562    KXJ69370.1    JYDQ01000499    KRY07301.1    JYDQ01000009    KRY22437.1    JYDI01000209    KRY48378.1    JYDH01000025    KRY38464.1    JYDJ01000512    KRX34809.1    JYDN01000258    KRX52286.1    JYDL01000006    KRX26626.1    KL367585    KFD62883.1    JYDK01000180    KRX73317.1    JYDW01000285    KRZ49986.1    JYDR01000106    KRY68661.1    JYDV01000007    KRZ44161.1    JYDT01000008    KRY92224.1    JYDS01000555    KRZ02797.1    GEHC01000921    JAV46724.1    JYDU01000375    KRX86446.1   
Pfam
PF05380   Peptidase_A17        + More
PF00665   rve
PF18701   DUF5641
PF03564   DUF1759
PF01565   FAD_binding_4
PF17921   Integrase_H2C2
PF09129   Chol_subst-bind
PF00628   PHD
PF00078   RVT_1
PF05585   DUF1758
PF01425   Amidase
Interpro
IPR040676   DUF5641        + More
IPR005312   DUF1759       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR041588   Integrase_H2C2       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR001841   Znf_RING       
IPR000477   RT_dom       
IPR008737   Peptidase_asp_put       
IPR002999   Tudor       
IPR000253   FHA_dom       
IPR000048   IQ_motif_EF-hand-BS       
IPR023631   Amidase_dom       
IPR036928   AS_sf       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57903   SSF57903       
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF75304   SSF75304       
SSF57756   SSF57756       

Ontologies

Topology

Length:
1144
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.46284
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1144
 
 

Population Genetic Test Statistics

Pi
25.807554
Theta
22.105944
Tajima's D
-1.663613
CLR
1.103306
CSRT
0.0415979201039948
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号