SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12297
Annotation
PREDICTED:_uncharacterized_protein_LOC101745010_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.643
 

Sequence

CDS
ATGGAGTCGTTAGTAGTAGATAAAATTACTGAACGTTTACCGACTACCACAGTTGATGCCTCTCTTTTATCGAATTTCGAAGACATAGCATTGGCAGACGATACTTACTTTAACCCAGGCCCGATCCAACTGTTGATTGGAGCTTCGATTTTCCCGCATCTGCTCTTATCGAACAAGGTTCAAGGACGGCCTTCGCATGTCTCGCCGATCGCGTTAGAGACTATCCTCGGTTATGTTATTGTTGGTGACGCTCCCGTTCGTGTAGCTAACAACGAGAGCGTTTCATATTGCTGTACCGGAGACCCGTTAGACTCCACGATTCGGAAGTTTTGGGAATTAGAGGAGGTAGACGTGCCGTCTGTACTCAGCCCCGAGGACAAAATGTCTGAGGAGTTTTATACCAGTACTACCACACGAGATAGTGACGGACGATACGTGGTGGCTTTGCCCTTTAAAGGTGATGTTAACACTCTCGGTAATTCGCGTCAAGCAAGTGAAAGTCAATTTTACTGCTTAGAAAGAAAGATGCAAGCTTCTCCGCAGCTAAAATTAGCGTACGACAACATCATTCTCGAATATTTAGAGAAGAACTATCTCTCAGCTGTAGATTGTGACAGTTCAGATATTTCTTATTTTATTCCGCATCATGGTGTAATCAGACAAGATAAGGTCACAACCAAATTAAGAGTCGTACTCGATGGTAGTTGTAAGACTACTACTAATGTTTCGCTCAATGATCTGTTATATCGTGGACAAAATTTCCAAGGAAATTTATTTAATATTATTATTAATTTTCGTTTGTTTCCGGTTGCCCTTTCCGCTGACATTCGTCTGATGTTTCTGAGTATTGGAGTCAGAGAATCTGACAGGCGTTTTCAACGCATTCTATATCGTTTTTCTCCTCAACAACCATTACAAGTTTACGAATTTAATCGTGTAGTTTTCGGGCTTAAGTCTAGTCCTTTTCATGCGTTGCGTACTATTAAACAGCTGGCAGCTGATGAAGGTGTCGCTTACCCTCGGGCCAGAGAAATTATTGATACTAGCCTGTATATGGACGATTTTGTTTATTCAATTCCAACTGAAGACGTCGGCATATCAACCGCTTCTGAGATGATAGGTCTCATGAAGGCCGGTCAGTTCGAGCTGGTGAAGTGGACGAGTAACTCACAAGTAGTGTTAGATTCGATCCCGCCGTCGCATCGCCTGCCAGGTGTCAAGGAGTTCGATGAGTCGAACCAGCATAAAGTACTCGGCTTGTGTTGGTCTCCTACGTCGGACAATTTTTGTATAAAAATTGACACTCCGATTGAAATTTGTACTAAACGTACAATACTGTCATGTGTTGCTAAAATATGGGACGTCATGGGATTTGTCGCACCGGTCGTCCTGTTCGTTAAACTTATTATTAAGCAGTTGTGGCTGAGCAATTGTGACTGGGATGACACTCCATCCGAAGATATAGTAAAAATGTGGAGCCGATTCAAAGAAGAACTTCCTTTGCTTTCTCATATAAAGATCCCACGTCACGTAGGTATGAACGTCGACAGCATCGCGACTATATTAGGTTTCGCGGACGCCAGTGAGAAAGCATATGGGGGTGTGATATATTTTCACGTTCAAAATAACAATGATAGTACAATACGTTTGATAACAGCAAAATCAAAGGTTTCTCCTAAAAAGGTTGTGTCGCTCGCCAGACTTGAGCTTTGCGCGATTCTCATACTCGCTCAGCTCATAAAAAATGTAGTAGTCGCTTGTCAAAATCGCATTGTTTTGCGCAATATATTCGCGTTTTCAGACTCAACAGTCGCACTTTGTTGGACACATTCATCGCCTCATCGATGGAGCACCTTTGTGGCTAACAGAGTGACGAAGATACAAAGCTATTTATCTCCACAAAATCTATATCACGTGTCTGGTAAAGACAATCCCGCTGATTGTTTGTCGCGTGGCCTCACTCCTTCCCAAATAATTAATCACCCGCATTGGTTTAGTGGCCCCTCTTGGGCACATTTGGATGTCGCGCAGTGGCCTGCTGTTCCTTTTAATCCTTCCGTAGAGCCTGAGGCGCCGGAAGAAAAGAAACAGACTTTTCTCGCCGCTACTTTAAATGAAAAATCTCCTATATTATCACTAGGAGATCGTATCTCATCTTGGTCTAAACTATTGCGCAGTGTAGTTTTCGTTTGTCGATTTGTAAAATTGTTACCTCACAGATATCGCGTGTCAGCATCGGATTATGAGTTCGCTGAGTTATTAATTCTTCGTGAACTTCAACGGTTTTATTTTCGCGCTGAGATCGCGAAGCTCGAGGAAGGTCAAGTATGTAGCCCTGCATTTCGACACTTAAAACCATTTCTTAAAGATGGAGTAATTAGAGTAGGGGGACGTTTAAGAAACTCTGACTTGAGCTACGACGAGAAATATCCCATTTTGCTTCCGAGAAAAGATCCGATCTTGAATTTACTTGTCGAATATCATCATAAATTAAATTGTCACGCCGGTCCTGACCTGCTGATGGCGCTCTTACGTCAGAAGTATTGGATACTTTCTGCTCGTAATTTAATTAGGAATAGGATACACAAATGCATGCCTTGCTTTCGACTTCGTCCTAAGTAA
Protein
MESLVVDKITERLPTTTVDASLLSNFEDIALADDTYFNPGPIQLLIGASIFPHLLLSNKVQGRPSHVSPIALETILGYVIVGDAPVRVANNESVSYCCTGDPLDSTIRKFWELEEVDVPSVLSPEDKMSEEFYTSTTTRDSDGRYVVALPFKGDVNTLGNSRQASESQFYCLERKMQASPQLKLAYDNIILEYLEKNYLSAVDCDSSDISYFIPHHGVIRQDKVTTKLRVVLDGSCKTTTNVSLNDLLYRGQNFQGNLFNIIINFRLFPVALSADIRLMFLSIGVRESDRRFQRILYRFSPQQPLQVYEFNRVVFGLKSSPFHALRTIKQLAADEGVAYPRAREIIDTSLYMDDFVYSIPTEDVGISTASEMIGLMKAGQFELVKWTSNSQVVLDSIPPSHRLPGVKEFDESNQHKVLGLCWSPTSDNFCIKIDTPIEICTKRTILSCVAKIWDVMGFVAPVVLFVKLIIKQLWLSNCDWDDTPSEDIVKMWSRFKEELPLLSHIKIPRHVGMNVDSIATILGFADASEKAYGGVIYFHVQNNNDSTIRLITAKSKVSPKKVVSLARLELCAILILAQLIKNVVVACQNRIVLRNIFAFSDSTVALCWTHSSPHRWSTFVANRVTKIQSYLSPQNLYHVSGKDNPADCLSRGLTPSQIINHPHWFSGPSWAHLDVAQWPAVPFNPSVEPEAPEEKKQTFLAATLNEKSPILSLGDRISSWSKLLRSVVFVCRFVKLLPHRYRVSASDYEFAELLILRELQRFYFRAEIAKLEEGQVCSPAFRHLKPFLKDGVIRVGGRLRNSDLSYDEKYPILLPRKDPILNLLVEYHHKLNCHAGPDLLMALLRQKYWILSARNLIRNRIHKCMPCFRLRPK

Summary

EMBL
GEZM01054789    JAV73399.1    GAIX01013989    JAA78571.1    GBBI01004276    JAC14436.1    + More
GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GALX01004947    JAB63519.1    ABLF02008594    ABLF02030698    ABLF02030705    ABLF02030709    ABLF02030854    ABLF02067347    ABLF02006304    ABLF02036268    GEZM01085145    GEZM01085143    JAV60187.1    GDHC01006469    JAQ12160.1    GBHO01044645    JAF98958.1    GBHO01044643    JAF98960.1    GBHO01044644    JAF98959.1    GGMS01010524    MBY79727.1    GGMR01002421    MBY15040.1    GEZM01054765    JAV73413.1    GGMR01017890    MBY30509.1    ABLF02041863    ABLF02035780    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    JXUM01030959    KQ560903    KXJ80414.1    ABLF02036131    ABLF02041527    ABLF02064049    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    GFTR01008866    JAW07560.1    GEBQ01028569    JAT11408.1    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    KK114194    KFM61875.1    LNIX01000069    OXA36894.1    LNIX01000016    OXA46198.1    ABLF02066034    GAMC01006864    JAB99691.1    LNIX01000007    OXA51795.1    GBHO01009080    JAG34524.1    GALX01000776    JAB67690.1    LBMM01012238    KMQ86334.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    LBMM01009202    KMQ88311.1    GBHO01023090    JAG20514.1    ABLF02005684    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    GDHC01014057    JAQ04572.1    GEZM01060254    JAV71154.1    GGMR01014165    MBY26784.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    ABLF02042806    LBMM01009551    KMQ88039.1    GBHO01006408    JAG37196.1    GBRD01007977    JAG57844.1    LNIX01000002    OXA59522.1    GEZM01054766    JAV73410.1    GGMR01010750    MBY23369.1    LNIX01000011    OXA48427.1    GGMR01013370    MBY25989.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GGMR01000737    MBY13356.1    GGMR01018294    MBY30913.1    ABLF02025193    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    GBBI01004410    JAC14302.1    GBBI01004408    JAC14304.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    GFTR01008874    JAW07552.1    GGMS01009443    MBY78646.1    LBMM01012077    KMQ86420.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GBHO01044316    JAF99287.1    ABLF02025958    ABLF02039606    JXUM01113346    KQ565681    KXJ70776.1    ABLF02008635    ABLF02023121    ABLF02065930    ABLF02065931    ABLF02008636    GGMR01018506    MBY31125.1   
Pfam
PF00665   rve        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF03564   DUF1759
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR008042   Retrotrans_Pao        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR036875   Znf_CCHC_sf       
IPR001995   Peptidase_A2_cat       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
873
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.00645
Exp number, first 60 AAs:
0.11562
Total prob of N-in:
0.01123
outside
1  -  873
 
 

Population Genetic Test Statistics

Pi
11.361299
Theta
23.616085
Tajima's D
-1.605362
CLR
15.671636
CSRT
0.047897605119744
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号