SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12285  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA009132
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.798
 

Sequence

CDS
ATGGAGGAAAAACTTTTCATCGACTTCATTCGGGAAAAATATCCGTCAATCGCGCCCGAATTCGAAGCCTATAGGGCCTCATTTGGTAATTATTCTCCCCCCGCATCTCTCGCCGCCGTCGCCAAACATGCCTCGCAGGCATGCCTCGCGTGCCCCGCCGCCGGTCCGTGTTCAAGCGCACGTACGCACGCCGCCGCCGTAGCGTCTAACGCCCCCGCCCCCGCTACCCCCGCGCCCGCGTCAATCACGTCAGTTTCGTCCGTCGCGACCTCAATAGCGTCTAGTTCAGGCTCCGATACCGAATCGGAGATGGACTTCGAGTCCGCGACTAGCCCTCAACCCGGAACCTCGGATGGGTTCCAAGCTGTAACGCGCGGTAAAAAGCGTACTCGCGTCGTGGAGTCCCGGAGCTCCATGACGAAGCAAACCAAGTCCGCGACCGCCTCCCGACCGCAGGTAGTCGTAACGCCGGAGTCGGACTCTGCCCGCCGCGTAATCCCACCGCCGCGCCCAAAAACCGCGCCCGCGCCTAAAACAGTTGTCCCGCCCCCGCTGATACTCCAGGAGAAGTCAGCGTGGAATCGCGTATCCCAGGCCCTTCAGGCCAACAAAATTAATTATACCCATGCGCGTAACGTCGCGCATGGGATTCAGATTAAGGTCGCAACGCCGGGCGACCATAGGGCCCCCTCTGCTTACCTCCGAAAGGAGAACATAGGTTATCACACCTATGCTCTTCAGGAGGACCGCGAACTCCGCGTAGTGATACGTGGAGTCCCCAAGGAACTCGACATAGACTACGTAAAGGAGGATCTGATCGGTCAGTCCCTCCCAATAATTAGTGTGCACCGGATGCACAGCGGACGCGGCAGACAGCCGTACAATATGATTCTCGTCGCGCTAGAATCAACCCCGGAGGCAAAGAAAAGAATCTCATGTCTCAAAACGATATGCGGCCTCTCCGGGGTCACCATCGAAGCCCCCCATAAACGTGGTACTCCCGGGCAGTGCCACAGGTGCCAGCTCTATGGCCACTCAGCGCGTAATTGCCACGCGCGCCCCCGCTGCGTGAAATGCCTCGGCGATCACGCAACCACAGAATGTTCGCGTGTTAGGGAAACCGCGACGGAACCCCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCGGCAAACTACCGCGGATGTCCTAGGGCTCCGCGTAAACGCCTGAACCACCCAGCCCCCCGAACCGTCGACCCAAAGACTTCGGCGCCTTCAGTGCCGAAACCAGCCTTCGTACCGGCTGCGGTTCCCACCGTCTCGGCGTGGAAAAAACCGCTGCCGTATACGAAGGAGGGAACACAAAACGTACCCCAGCTCCCGCCTGCGACACGTCACGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTACCGCCCCCCGCAACCCTCAGTCGTCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTAAACTTTGACCGTCTGCGATCGTTCGCAGATGCTATCCCATTCTACAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTCGAATTCCTCCGCGATAATCTTGTAGATATTTTGTTAGTGCAGGAGACCTGTCTGAAGCCCTCGCGTCGTGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCTCTGCACGTTGTTCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTTGGCATGGGAGACTCCGTCATCCTGGCAGGCGATATAAATTGCCACCACACTAGGTGGAACTGCCATCGTACGAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACTTTTGAAGTAGTCGGTTCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTACGTTCCATCGAAGCACTGTCAGAGCTCGACTCAGACCACCGACCTGTCCTTATGCAGCTCGGTCGCCCTCACAACCCAGCCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGAAGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCTATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCTCCGAACTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCCTAAGTGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCCCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCTGAATACCACTTCGAGCATCCCACTCCCTAATAGGCGCGCAAACACCTCCGCCGTTAGCCCCGTCACTCTCTTTGGCCAGCCCATACCGTGGGCCTCGCAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATTAAAACGGTACGCGACCGTGCCGCCTTCATATTAGGACGTCTCTACCCTATGCTTTGCAAGCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGCATACGCCCCGTTATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAGCCCCTTCAGGTTATTCAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCTGAGGAACGTGGATCTCCACGATGACCTGGAGCTTGACTCTGTCAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGATCGGAGCTAAGTTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGACTCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTACGTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGACCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAACAACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTCGTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTCGGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTACCCTGACAGAATAATGAACACATATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTAGTAGAACCGTACAACGCCACACTTTCAGTTCATCAATTAGTTGAAAACACAGACGAAACCTACTGTATCGACAACGAGGCTCTCTACGATATCTGCTTCCGCACGCTAAAACTATCCACACCCACATACGGCGACCTGAACCACCTGGTGTCGCTGACCATGTCCGGCGTGACGACGTGCCTGCGGTTCCCCGGACAGCTGAACGCCGACCTGCGCAAGCTGGCGGTCAACATGGTGCCCTTCCCGCGTCTGCACTTCTTCATGCCCGGCTTCGCGCCGCTGACGTCACGCGGCAGCCAGCAGTACCGCGCGCTCACCGTGCCGGAGCTCACGCAGCAGATGTTCGACGCCAAGAACATGATGGCCGCCTGCGACCCGCGCCACGGCCGCTACCTCACCGTCGCCGCCATCTTCCGCGGCCGCATGTCCATGAAGGAGGTCGACGAACAGATGCTTAACATCCAGAACAAGAACTCCTCATACTTCGTGGAATGGATCCCCAACAACGTGAAGACCGCCGTGTGCGACATTCCCCCTCGTGGTCTCAAGATGGCCGCCACCTTCATCGGTAACTCCACCGCCATCCAGGAGCTGTTCAAGCGCATCTCGGAACAGTTTACCGCTATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACCGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCTGAGAGCAACATGAACGACCTTGTCTCCGAGTACCAACAGTACCAGGAGGCCACCGCCGACGAGGACGCAGAGTTTGACGAGGAGCAGGAGCAGGAGATCGAGGACAACTAA
Protein
MEEKLFIDFIREKYPSIAPEFEAYRASFGNYSPPASLAAVAKHASQACLACPAAGPCSSARTHAAAVASNAPAPATPAPASITSVSSVATSIASSSGSDTESEMDFESATSPQPGTSDGFQAVTRGKKRTRVVESRSSMTKQTKSATASRPQVVVTPESDSARRVIPPPRPKTAPAPKTVVPPPLILQEKSAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRAPSAYLRKENIGYHTYALQEDRELRVVIRGVPKELDIDYVKEDLIGQSLPIISVHRMHSGRGRQPYNMILVALESTPEAKKRISCLKTICGLSGVTIEAPHKRGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHATTECSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRLNHPAPRTVDPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKEGTQNVPQLPPATRHAPQPLLAPRPAPAYRPPQPSVVNDFALVRDFVTAVNFDRLRSFADAIPFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLLHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDINCHHTRWNCHRTNVNGRRLDAFIDDLTFEVVGSPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEALSELDSDHRPVLMQLGRPHNPATVTRTMVDWNKLGTCLAEAAPPILPYGPDSNLSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSSELRNLLRVRNAAIRAYDRLPTHSNRIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIRNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLPTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSTAVLFKRGRPLNTTSSIPLPNRRANTSAVSPVTLFGQPIPWASQVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCKRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSVSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMIGAKFWEIISDEHGIDPTGAYHGDSDLQLERINVYYNEASGGKYVPRAILVDLEPGTMDSVRSGPFGQIFRPDNFVFGQSGAGNNWAKGHYTEGAELVDSVLDVVRKEAESCDCLQGFQLTHSLGGGTGSGMGTLLISKIREEYPDRIMNTYSVVPSPKVSDTVVEPYNATLSVHQLVENTDETYCIDNEALYDICFRTLKLSTPTYGDLNHLVSLTMSGVTTCLRFPGQLNADLRKLAVNMVPFPRLHFFMPGFAPLTSRGSQQYRALTVPELTQQMFDAKNMMAACDPRHGRYLTVAAIFRGRMSMKEVDEQMLNIQNKNSSYFVEWIPNNVKTAVCDIPPRGLKMAATFIGNSTAIQELFKRISEQFTAMFRRKAFLHWYTGEGMDEMEFTEAESNMNDLVSEYQQYQEATADEDAEFDEEQEQEIEDN

Summary

Uniprot
ProteinModelPortal
PDB
6EVW     E-value=0,     Score=2115

Ontologies

Topology

Length:
1840
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.12083
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00001
outside
1  -  1840
 
 

Population Genetic Test Statistics

Pi
18.245106
Theta
17.441669
Tajima's D
0
CLR
19.274077
CSRT
0.370481475926204
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 FWEIISDEHGIDPTGAYHGDSDLQLER 100.00 2e-14
28556443 FVEWIPNNVK 100.00 2e-14
28556443 FPGQLNADLR 100.00 2e-14
26822097 TAVCDIPPR 100.00 4e-14
26280517 SGNIIVTTSVVDPK 100.00 4e-14
25044914 SGNDIIIR 100.00 4e-14
24402669 SGNIDFEGK 100.00 4e-14
27102218 GHYTEGAEIVDSVIDVVR 100.00 4e-14
28467696 SGNISVNYK 100.00 4e-14
21761556 LHFFMPGFAPLTSR 100.00 4e-14
28556443 SGPFGQIFRPDNFVFGQSGAGNNWAK 100.00 4e-14
28556443 SGPFGQIFRPDNFVFGQSGAGNNWAK 100.00 4e-14
28556443 SGPFGQIFRPDNF 100.00 4e-14
28556443 SGPFGQIFRPDNF 100.00 4e-14
28556443 LSTPTYGDLNHLV 100.00 1e-10
28556443 LHFFMPGFAPLTSR 100.00 1e-10
28556443 QIFRPDNFVFGQSGAGNNWAK 100.00 7e-10
28556443 QIFRPDNFVFGQSGAGNNWAK 100.00 7e-10
28556443 QIFRPDNFVFGQSGAGNNWAK 100.00 7e-10
28556443 QIFRPDNFVFGQSGAGNNWAK 100.00 7e-10
28556443 QIFRPDNFVFGQSGAGNNWAK 100.00 7e-10
28556443 QIFRPDNFVFGQSGAGNNWAK 100.00 7e-10
28556443 NSSYFVEWIPNNVK 100.00 7e-10
28556443 NSSYFVEWIPNNVK 100.00 7e-10
28556443 QLFRPDNFVFGQSGAGNNWAK 95.24 2e-09
28556443 QLFRPDNFVFGQSGAGNNWAK 95.24 2e-09
28556443 QLFRPDNFVFGQSGAGNNWAK 95.24 2e-09
28556443 QLFRPDNFVFGQSGAGNNWAK 95.24 2e-09
28556443 QLFRPDNFVFGQSGAGNNWAK 95.24 2e-09
28556443 QLFRPDNFVFGQSGAGNNWAK 95.24 2e-09
28556443 QLFRPDNFVFGQSGAGNNWAK 95.24 2e-09
28556443 NMMAACDPR 95.24 2e-09
28556443 LAVNMVPFP 100.00 4e-09
27102218 IMNTYSVVPSPK 100.00 6e-07
26822097 MREIVHIQAGQCGNQIGAK 100.00 8e-07
28467696 PDIDNAVIVR 100.00 8e-07
28556443 LHFFMPGFAP 100.00 9e-07
28556443 GHYTEGAELVDSVLDVVR 100.00 1e-05
28556443 GHYTEGAELVDSVLDVVR 100.00 1e-05
28556443 GHYTEGAELVDSVLDVVR 100.00 1e-05
28556443 GHYTEGAELVDSVLDVVR 100.00 1e-05
28556443 GHYTEGAELVDSVLDVVR 100.00 1e-05
28556443 GHYTEGAELVDSVLDVVR 100.00 1e-05
28556443 FWEIISDEHGIDPTGAYHGDSDLQLER 100.00 1e-05
28556443 FWEIISDEHGIDPTGAYHGDSDLQLER 100.00 1e-05
28556443 MAATFIGNSTAIQELFK 100.00 2e-05
28556443 TTCLRFPGQLNADLR 100.00 2e-05
26280517 INTFIIK 100.00 5e-05
27102218 MSMKEVDEQMINIQNK 100.00 5e-05
28556443 VSDTVVEPY 100.00 5e-05
28556443 MPGFAPLTSR 100.00 7e-05
28556443 MAATFIGNSTAIQELFK 100.00 1e-04
28556443 MAATFIGNSTAIQELFK 100.00 1e-04
28556443 MAATFIGNSTAIQELFK 100.00 1e-04
28556443 MAATFIGNSTAIQELFK 100.00 1e-04
28556443 MAATFIGNSTAIQELFK 100.00 1e-04
28556443 MAATFIGNSTAIQELFK 100.00 1e-04
28556443 MAATFIGNSTAIQELFK 100.00 1e-04
28556443 LSTPTYGDLNHLVSLTMSGVTTCLR 100.00 1e-04
28556443 LSTPTYGDLNHLVSLTMSGVTTCLR 100.00 1e-04
28556443 AATFIGNSTAIQELFK 100.00 5e-04
28556443 TAVCDIPPK 100.00 6e-04
28556443 TFIGNSTAIQEIFK 100.00 6e-04
28556443 INVYYNEASGGKYVPR 100.00 6e-04
31223520 ALTVPELTQQMFDAK 100.00 6e-04
26822097 GHYTEGAEIVDSVIDVVRK 100.00 6e-04
26280517 NQITTNPENTVFDAKR 100.00 6e-04
25044914 NSSIDPDIPIIIK 100.00 6e-04
27102218 INVYYNEASGGKYVPR 100.00 6e-04
28467696 NSSPQTISVEAYR 100.00 6e-04
28556443 NSSYFVEWIPNNVK 100.00 6e-04
28556443 NSSYFVEWIPNNVK 100.00 6e-04
28556443 NSSYFVEWIPNNVK 100.00 6e-04
28556443 NSSYFVEWIPNNVK 100.00 6e-04
28556443 NSSYFVEWIPNNVK 100.00 6e-04
28556443 NSSYFVEWIPNNVK 100.00 6e-04
28556443 NSSYFVEWIPNNVK 100.00 6e-04
28556443 NMMAACDPR 100.00 6e-04
28556443 MAATFIGNSTAIQELFK 100.00 6e-04
28556443 LSTPTYGDLNHLVSL 100.00 8e-04
28556443 VSDTVVEPYNATLSVH 100.00 0.002
28556443 TAVCDIPPR 100.00 0.002
28556443 TAVCDIPPR 100.00 0.002
31223520 LHFFMPGFAPLTSR 100.00 0.002
31223520 AILVDLEPGTMDSVR 100.00 0.002
21761556 ISEQFTAMFR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTS 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLTSR 100.00 0.002
28556443 LHFFMPGFAPLT 100.00 0.002
28556443 LAVNMVPFPR 100.00 0.002
28556443 LSTPTYGDLNHLVSLTM 100.00 0.002
28556443 SGPFGQIFRPDNF 100.00 0.003
28556443 QLTHSLGGGTGSGMGTLLISK 100.00 0.003
28556443 QLTHSLGGGTGSGMGTLLISK 100.00 0.003
28556443 TTCLRFPGQLNADLR 100.00 0.004
28556443 VDLEPGTMDAVR 100.00 0.004
28556443 NMMAACDPR 100.00 0.004
31223520 LHFFMPGFAPLTSR 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 AFLHWY 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 ALTVPELTQQMFDAK 100.00 0.004
28556443 AILVDLEPGTMDSVR 100.00 0.004
28556443 AILVDLEPGTMDSVR 100.00 0.004
28556443 SLGGGTGSGMGTLLISK 100.00 0.004
28556443 SLGGGTGSGMGTLLISK 100.00 0.004
31223520 EVDEQMLNIQNK 100.00 0.004
21761556 LAVNMVPFPR 100.00 0.004
28556443 AILVDLEPGTMDSVR 100.00 0.004
28556443 AILVDLEPGTMDSVR 100.00 0.004
28556443 AILVDLEPGTMDSVR 100.00 0.004
28556443 AILVDLEPGTMDSVR 100.00 0.004
28556443 ILVDLEPGTMDSVR 100.00 0.004
28556443 YLQEDLSSEK 100.00 0.004
28556443 LHFFMPGFAPLT 100.00 0.006
28556443 VDLEPGTMDSVR 100.00 0.006
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号