SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12283
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Full name
Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2       + More
Retrovirus-related Pol polyprotein from type-2 retrotransposable element R2DM      
Alternative Name
Retrovirus-related Pol polyprotein from type I retrotransposable element R2
Retrovirus-related Pol polyprotein from type II retrotransposable element R2DM
Location in the cell
Mitochondrial   Reliability : 2.62
 

Sequence

CDS
ATGAGGGAGCGATGCGCGCAGATAACCGGACGGGACTTCGTGCAGTTCGTGCACACGCACATCAACGCCCTCCCATCCCGCATTCGCGGATCGAGAGGGCGTAGAGGTGGGAGTGAGTCGGCGTTGACCTGCCGTGCTGGTTGCAGGGTCAGGGAGACGACGGCTCACATCCTACAGCAGTGTCACAGAACACACGGCGGCCGGATTCTACGACATAACAAGATTGTCTCTTTCGTGGCGAAAGCTATGGAAGAGAACAAGTGGACGGTTGAGCTGGAGCCTAGGCTACGAGCATCGGTGGGTCTCCGTAAGCCGGATATTATCGCCTCCAGGGATGGTGTCGGAATGATCGTGGACGTGCAGGTCGTCTCGGGCCAGCGGTCGCTTGATGAGCTCCACCGTGAGAAACGTAATAAATACGGGAATCACGGGGAGCTGGTTGAGTTGGTCGCAGGTAGACTAGGACTTCCGAAAGCTGAGTGTGTGCGAGCCACTTCGTGCACGATATCTTGGAGGGGAGTATGGAGCCTGGCTTCTTTTAAGGAGTTGAGGACCATAATCGGGCTTCGGGAACCGACACTGCAGACTGTTACAATCTTAGTGTTGAGAGGATCGCATATGAACTGGACCAGGTTCAATCAGATGACGTCCGTCATGGGGGGCGGCATTGGTTGA
Protein
MRERCAQITGRDFVQFVHTHINALPSRIRGSRGRRGGSESALTCRAGCRVRETTAHILQQCHRTHGGRILRHNKIVSFVAKAMEENKWTVELEPRLRASVGLRKPDIIASRDGVGMIVDVQVVSGQRSLDELHREKRNKYGNHGELVELVAGRLGLPKAECVRATSCTISWRGVWSLASFKELRTIIGLREPTLQTVTILVLRGSHMNWTRFNQMTSVMGGGIG

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger   Aspartyl protease   Protease  
Feature
chain  Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2
EMBL
AB076841    BAC01114.1    M16558    AAB59214.1    AF436853    AAQ04479.1    + More
KZ150483    PZC70716.1    GBBI01004849    JAC13863.1    GBYB01008309    JAG78076.1    LBMM01006940    KMQ90176.1    AF015816    AAB94040.1    KQ971997    KYB24671.1    EU574809    ACB70316.1    KQ972640    KXZ75830.1    GFWV01002964    MAA27694.1    LBMM01009160    KMQ88340.1    GFJQ02003336    JAW03634.1    AAZX01024756    AAZX01024918    AAZX01002322    GFJQ02001120    JAW05850.1    GFWV01001919    MAA26649.1    GFJQ02007114    JAV99855.1    AAZX01010802    AAZX01015897    FJ461304    ACJ71597.1    L00950    GACK01007407    JAA57627.1    GFJQ02004269    JAW02701.1    KF925878    AHN53448.1    GFWV01010717    MAA35446.1    U13035    AAB60229.1    U13032    AAB60226.1    U13031    AAB60225.1    LBMM01007077    KMQ90064.1    U13033    AAB60227.1    GBBI01004906    JAC13806.1    JQ082370    AFM44926.1    GEDV01005279    JAP83278.1    GGMS01004512    MBY73715.1    GFAA01001120    JAU02315.1    AAZX01004801    AAZX01023289    AY682792    AAV85443.1    GBBI01004905    JAC13807.1    AAZX01023287    U13034    AAB60228.1    GFTR01008394    JAW08032.1    JO841887    AEO33504.1    AF015819    AAC34906.1    GEDV01003881    JAP84676.1    X51967    U13640    AAA21258.1    GFAC01005513    JAT93675.1    AAZX01023288    AF015815    AAC34903.1    ABLF02012459    ABLF02012460    GFAC01000014    JAT99174.1    AB201408    BAE46603.1    U81816    AAB41011.1    AY682793    AAV85444.1    ABLF02003433    LBMM01008531    KMQ88807.1    JO840990    AEO32607.1    U81811    AAB41015.1    AF015685    AAB94032.1    U81809    AAB41003.1    U81820    AAB41012.1    U81814    AAB41013.1    JN937621    AFO20000.1    GFAC01005869    JAT93319.1    LNIX01000056    OXA37477.1    KJ958674    AIL01110.1    L00951    U81810    AAB41004.1    AY682794    AAV85445.1    GACK01009629    JAA55405.1    GDHC01013113    JAQ05516.1    JN937619    AFO19998.1    JN937617    AFO19996.1    JN937620    AFO19999.1    ABLF02008889    AB201416    BAE46611.1    EU854578    ACJ46647.1    AB097122    BAC82590.1    GBRD01016679    JAG49148.1    KZ430017    PIS84891.1    JN937618    AFO19997.1   
Pfam
PF00078   RVT_1        + More
PF00096   zf-C2H2
Interpro
IPR000477   RT_dom        + More
IPR013087   Znf_C2H2_type       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF50630   SSF50630       

Ontologies

Topology

Length:
224
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02794
Exp number, first 60 AAs:
0.00162
Total prob of N-in:
0.22467
outside
1  -  224
 
 

Population Genetic Test Statistics

Pi
11.924621
Theta
15.947436
Tajima's D
-1.112182
CLR
3.192031
CSRT
0.11764411779411
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号