SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12262
Annotation
PREDICTED:_uncharacterized_protein_LOC105386827_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.844
 

Sequence

CDS
ATGACGAAGGGGTACGTAGAAACGAGGTTGAATACCATCGAAGATTACTGGCAAATATTTAAAGAAACACACGACACTCTTGTGAAGTCCCTCACCAAAGAAAAAAGATCGGATATATTATATTTCAAAGAAAATGTGTATAGCAATATTGAAGAGTTATATATGGATACAACATCAGATTTAAAGGATACTTTGTCCAATTTCGTACAAACTGCAGGTACCCCCACACCAATTAAACAACAAGATTTGAATATAAAATTACCCCATATACAATTACCTACGTTTACTGGACATTATGATGATTGGCCGACCTACAACGACATATTTACTTCACTTGTTCATCACAATATCACATTATCTAAAGTTCAAAAATTACATTACTTAAAGGCAAGTGTTGCTGATGAAGCGGCTTCTCTACTCAAACACATATCAGTGACTGAAAGCAATTATGAACAGGCATGGGACATTTTAAAACAGAGATATGGTAATAAGAAACTTATTGTTAATTCACTTTTAAGAAGATTGTTTCAACAACCAAAAATAAACACACCTAATGCCATTCAACTAAAAAGATTATTAGATACTACAACTGAATGCCTGAGCAGCCTACAAAACCTTAACTTACCTGTTGAGTCATGGGATTTAATTATCATCTACATAATTGTGCAAAGACTGGATCCTGAAACACATAAAGCATGGGAAGAGTATAGTTTCCATAGAAATAGTGAAGACCTACCTACTTGGCAAGAAATGAAAAACTTTCTAGATTGTAAATTTAGAACAATGGAATTAGTAACATACACACCTCAAACAAAAGAATTGAAATCTTATAAACAAAAAACATTCCAAATTTCCACAACAGAAAAGATCTGTATTAAATGTAAAGAAAATCATACCCTTTGTCATTGTGAAGAATTTATTAAACTGTTACCAGATGAACGAATTGGTTTTGTGAAGAACAAGAATTTATGCTATAATTGCTTACTACCAGGACACCCAGTGTTTAAGTGTCGACTCAGAATATCATGCAGAATCTGTGGTAAGCGGCACCATTCGTTACTACACAAAACAATCAATGGATTAGAGACAAACTATAAACAAGTTGAAGACACAAACATCCAACCAGGCCCTATAAAGGATAATGATGCAGACGTTGCTATACTGTCGCATATGGCGACAAAGAGGTCCACAGCATTGCTGGCCACAGCATTGATAACTGTTAAGAATAGTACAGGACATTATACAGTATTGCGCGCCTTAATAGATCAAGGGTCACAGGCTAATTTTATTAGTGAAAGAGCAGCACAACTTTTGAAAGTCAAAGGAACACCCACTAAGGGGACAATCACTGGAGTTGGATCTACACAAACGGAAGTAAATCTGGCAGTCCAGCTTGAAATATTATCTAGATACCAATGCAATTTCAAGCTCAACGTGGAAGCATATGTGATGCCTTCACGTTTAACAACATACTTACCGTCCACAACTATTGCCGACTCCACACTCACCTGGTCGCATTTGAAAGGTCTCAAGCTGGCAGATCCCACCTTTAATCAACCAGGGAGAGTTGATATGCTTCTAGGTGTAGAAGTATATGCAGCCATTCTGAAAAATGAAATTATTCGAGGTCCTCCTGGCTCTCCATGCGCACAACATACAAGTTTTGGATGGATTCTCTTTGGAAAGGTACACAATGACATTGAAGAAAGGAAAATAACAGTAATGCACCACCACATGGATTTTGATGAACTGTTACACACATTATGGGAGTTAGACTGTGATAATCAAAGAAAACTTACACAAGAAGAGGAACTCTGTGAGAACATTTATTATGAAAATGTTAGGAGAGACAATGAAGGAAGATACATTGTGAAATTACCTTTTAAATCATATGTCATACTAAGTACAGAAGGTAATACCAGGGATATAGCACTAAGAAGATTAACACAACTAGAGAGAAGATTACAGAGAGACATGAAGTTAAGGACAGAATACACTAAAGTGATGCAAGAATATATTGAATTGAATCATATGGAAGAAGTACCAGAAGAAGAATTAGGGAAACCCTCTGTCTACCTTCCTCATCATGCAGTTGTAAAGGATACAAGTGAGACTACCAAAGTAAGAACTGTGTTCAATGCCTCCTCAATGGGATCTAATAATGTTTCCATTAATGATGAGTTACTAGTTGGCCCACAATTGCAAGAAGACATGAGATCATTGGATGCAGATTACCAACGAATCTTGTGGAGAATTGATCCAAATTTTAAAGTCAAAGATTACAGATTGCTTCGGGTAACATTTGGAACTGCTTCAGCTCCGTTCCTTGCTGTAAGAACTCTACAACAAGTTGCAGAAGATGAAGGCAAAGATTTCCCTGAAGCAGCTAGAATGATTAAGGAAGACTTCTGGATGGATGACTTATTATCTGGTAACGATACAGTAAGTGAAGCCATTGAATCAGCAAGAAATGTCAGTGACATCTTGAATCGTGGCGGTTTCAAATTACAAAAATGGTCTTCTAACAGTATTGAATTTATGAAAAATATTTCACCTACAGAAAGAAGTACATTGATAAATGTGGATATGAACCTGGGAGGAACTGTTAGAACATTGGGGTTATCATGGAATATAGGAGATGATGTGCTACAGTATAATCTTAATTTGCCAGAAGTGCCACTTACCATTACTAAGAGAAGTATACTTGCTGAGATACAACGCTTATTTGATCCACTTGGTTGGATAGCACCTGCCTTGTTACCTGGAAAACTAATAATACAAAGACTATGGTTGAAAAGACTTACCTGGGATGAAGAAGTAGACTCTGAAACTAAAAGAGATTGGTTAGAGATGAGAAACAACTTAAATTATTTAAAGGAAATTAAAATACCACGCTGGTTACTTATTACTAGTGATGTCATAGAAGATGTGTCAATACATGGATTTTGTGATGCATCAACAATTGCATATGGAGCAGTTGCTTACCTGAGAGTCAAAACTTACAATAATGAATATAAAACTATGCTGATAGCAGCGAAGACTAGAGTCGCACCTGTTAAACCAGTCTCACTGCCCCGTTTGGAACTGTGCGGTGCGGTGTTATTATCAAAGCTCTTGAAACACATCAGTCGTGCTACACGGATACCAAGGAAACAAATCTTTGCTTGGACAGATTCTACCATAGTACTATCATGGCTTACTGGAGACCCGACGAGATGGCAAACATTTGTGAGAAATCGTGTAGTAACAGTGCTTGACAATATTGGAAATGCATGGTATCATGTACATTCTCAAGACAACCCTGCAGACATAGCATCAAGAGGAATGCTTCTTTCAGATCTCAAAGAATTTAGTTTATGGTGGAACGGCCCTAAATGGCTCACCCATGAAGAAATATTGATGTCTCGCGGAGATAATATTTCTACTGACCTAGAGTTGAGAAGAACAATTATCAATACAAACATAAAAATAGACAATAATCATAATGAAGGAAATTATATACACAATCAATTTGAAAACTTTAACAACTTGATGGAACTACAAAGAACTATTGTGTACTGCAAAAAATTCTTGAATTTTAAACGAAGTAGCGATAACATTAGTACAAAGTGCTTCAGCCCACTGGAGTTAACAGAGGCTCTTGAAACATGTGTGCGGTTAGCACAACATAATGATTTTGAACATGAAATCCACGATTTGTTACAAGGGACTGGAGTAAGTAATAGAAGTGTACTGAAGAATCTCAATCCTTATCTAGACAAGAAAGGTCTTCTCAGAGTAGGCGGTCGATTACGAAATGCGGAAATGGAAAATGACGCTAAATATCCTATGATCATAAGTCATAAGAACCCCATTGCAACATTGATAGTTAGTGATGCACACTTGAAGACACTTCATGGAGGACTCCAACTCACAATGAATTTTGTTAGATCAAGATTCTGGATCATAAGAGTAAAATCATTAATATCAGCTACAATACATAAATGTTTAATATGTGCAAAGCAGAAGGCTAAGGTCCGACACCAACTCATGGGAGACTTACCTGCAGCACGAGTAACACCCACTCGTCCATTCCTACACTCAGGAGTAGATTTTGCAGGCCCACTACAGATTCTGGTTTCCAGAGGAAGAGGCATGAAATGCACTAAGGGATACATATGTATATTTATATGCATGTCAACTAAAGCAATCCACTTGGAACTGGTTGGAGATTTAAGCACCGAGTCATTTTTAGGATGTTTTAGAAGATTTGTTGCCAGAAGAGGTCGATGCTCCCACATTTGGAGTGATCAAGGTACAAACTTTGTAGGAGCCAGTAAAGAATTAGCTAAAATGTGGCAAGAAGCAAAATTAAGTATACCTGAAGATTTAATAAACATTTTAGCTGAAGATGGAACCCATTGGCACTTTAACCCACCTTATAGCCCAAATTTTGGAGGTTTATGGGAAGCTGGGGTGAAATCTATAAAATATCACTTAAGAAGAATTCTTGATAGAACACTTACCTTTGAAGAGATGTCCACCACACTGTGCCAGATTGAAGCCTGCTTAAACTCACGGCCACTATGTCCAATAGCTCATAATGATATTGACAATTTAAATGTACTTACTCCTGGACACTTCCTCATTGGAGAAGCTCCAATCAATATACCTGAACCAGATCTTAGCCAAGTGAATGTAAACAGACTGTCTAGATGGCAACATACTCAGAGGATACTTCAAAACTTTTGGCATAAATGGAAGACGGAATATCTCACACGTTTACAACAAAGACCTAAATGGTTAACTTTAAAGGATGAGTTTAAAATTGGAGAAGTGGTTCTGATTAAGGAAGATCACCTTCCTCCGGGTAAATGGGCCTTAGGTCGCATAGTTGAAAAATATCCTGGCTCTGATAACATCTGTAGAGTTTACAGCTTAAAATGTTGTGGTAAATTGATTAAGAGATCCATTAGTAGACTGTGTAAATTGCCAATTAATGAATAA
Protein
MTKGYVETRLNTIEDYWQIFKETHDTLVKSLTKEKRSDILYFKENVYSNIEELYMDTTSDLKDTLSNFVQTAGTPTPIKQQDLNIKLPHIQLPTFTGHYDDWPTYNDIFTSLVHHNITLSKVQKLHYLKASVADEAASLLKHISVTESNYEQAWDILKQRYGNKKLIVNSLLRRLFQQPKINTPNAIQLKRLLDTTTECLSSLQNLNLPVESWDLIIIYIIVQRLDPETHKAWEEYSFHRNSEDLPTWQEMKNFLDCKFRTMELVTYTPQTKELKSYKQKTFQISTTEKICIKCKENHTLCHCEEFIKLLPDERIGFVKNKNLCYNCLLPGHPVFKCRLRISCRICGKRHHSLLHKTINGLETNYKQVEDTNIQPGPIKDNDADVAILSHMATKRSTALLATALITVKNSTGHYTVLRALIDQGSQANFISERAAQLLKVKGTPTKGTITGVGSTQTEVNLAVQLEILSRYQCNFKLNVEAYVMPSRLTTYLPSTTIADSTLTWSHLKGLKLADPTFNQPGRVDMLLGVEVYAAILKNEIIRGPPGSPCAQHTSFGWILFGKVHNDIEERKITVMHHHMDFDELLHTLWELDCDNQRKLTQEEELCENIYYENVRRDNEGRYIVKLPFKSYVILSTEGNTRDIALRRLTQLERRLQRDMKLRTEYTKVMQEYIELNHMEEVPEEELGKPSVYLPHHAVVKDTSETTKVRTVFNASSMGSNNVSINDELLVGPQLQEDMRSLDADYQRILWRIDPNFKVKDYRLLRVTFGTASAPFLAVRTLQQVAEDEGKDFPEAARMIKEDFWMDDLLSGNDTVSEAIESARNVSDILNRGGFKLQKWSSNSIEFMKNISPTERSTLINVDMNLGGTVRTLGLSWNIGDDVLQYNLNLPEVPLTITKRSILAEIQRLFDPLGWIAPALLPGKLIIQRLWLKRLTWDEEVDSETKRDWLEMRNNLNYLKEIKIPRWLLITSDVIEDVSIHGFCDASTIAYGAVAYLRVKTYNNEYKTMLIAAKTRVAPVKPVSLPRLELCGAVLLSKLLKHISRATRIPRKQIFAWTDSTIVLSWLTGDPTRWQTFVRNRVVTVLDNIGNAWYHVHSQDNPADIASRGMLLSDLKEFSLWWNGPKWLTHEEILMSRGDNISTDLELRRTIINTNIKIDNNHNEGNYIHNQFENFNNLMELQRTIVYCKKFLNFKRSSDNISTKCFSPLELTEALETCVRLAQHNDFEHEIHDLLQGTGVSNRSVLKNLNPYLDKKGLLRVGGRLRNAEMENDAKYPMIISHKNPIATLIVSDAHLKTLHGGLQLTMNFVRSRFWIIRVKSLISATIHKCLICAKQKAKVRHQLMGDLPAARVTPTRPFLHSGVDFAGPLQILVSRGRGMKCTKGYICIFICMSTKAIHLELVGDLSTESFLGCFRRFVARRGRCSHIWSDQGTNFVGASKELAKMWQEAKLSIPEDLINILAEDGTHWHFNPPYSPNFGGLWEAGVKSIKYHLRRILDRTLTFEEMSTTLCQIEACLNSRPLCPIAHNDIDNLNVLTPGHFLIGEAPINIPEPDLSQVNVNRLSRWQHTQRILQNFWHKWKTEYLTRLQQRPKWLTLKDEFKIGEVVLIKEDHLPPGKWALGRIVEKYPGSDNICRVYSLKCCGKLIKRSISRLCKLPINE

Summary

EMBL
ODYU01008608    SOQ52337.1    KQ460036    KPJ18393.1    KQ458473    KPJ05885.1    + More
LBMM01008464    KMQ88855.1    LBMM01007859    KMQ89359.1    GEZM01060254    JAV71154.1    LNIX01000036    OXA39969.1    LBMM01009964    KMQ87756.1    RSAL01000327    RVE42512.1    LBMM01010405    KMQ87487.1    LBMM01010417    KMQ87475.1    LBMM01008324    KMQ88972.1    LNIX01000007    OXA51795.1    LNIX01000002    OXA60848.1    LNIX01000016    OXA46198.1    GAMC01003146    JAC03410.1    LBMM01009645    KMQ87967.1    OXA59522.1    LBMM01009551    KMQ88039.1    LBMM01009746    KMQ87900.1    LBMM01009898    KMQ87805.1    LBMM01009688    KMQ87939.1    GFTR01008874    JAW07552.1    NWSH01000070    PCG79985.1    AJ487856    CAD32253.1    LBMM01009888    KMQ87813.1    KK114194    KFM61875.1    ABLF02022040    ABLF02056888    AY180917    AAN87269.1    GEHC01000864    JAV46781.1    GBBI01004211    JAC14501.1    GBBI01004140    JAC14572.1    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    GBBI01004139    JAC14573.1    EF426679    ABP48078.1    GEZM01066272    JAV68024.1    LBMM01009202    KMQ88311.1    GEHC01000869    JAV46776.1    GGMR01020322    MBY32941.1    GGMS01010815    MBY80018.1    GEZM01012999    JAV92824.1    KQ460500    KPJ14270.1    GGMR01000448    MBY13067.1    ABLF02041590    ABLF02042806    KQ458793    KPJ04955.1    GGMR01020500    MBY33119.1    JXUM01113346    KQ565681    KXJ70776.1    LBMM01011283    KMQ86917.1    CR954257    CAJ14165.1    ABLF02004142    NWSH01001945    PCG69607.1    ABLF02042264    KQ460205    KPJ16960.1    GGMS01006802    MBY76005.1    GEZM01018629    GEZM01018623    JAV90127.1    KQ459312    KPJ01687.1    KQ460970    KPJ10166.1    ABLF02041505    GGMS01010524    MBY79727.1    ABLF02016109    ABLF02016113    U23420    AAB03640.1    GGMR01002340    MBY14959.1    ABLF02035780    ABLF02022815    ABLF02023842    ABLF02028949    ABLF02058391    LBMM01009863    KMQ87831.1    ABLF02030698    ABLF02030705    ABLF02030709    GGFJ01000337    MBW49478.1    GEZM01085145    GEZM01085143    JAV60187.1    ABLF02030854    ABLF02067347    GALX01004947    JAB63519.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    LBMM01011516    KMQ86784.1    ABLF02003232    ABLF02003233    LNIX01000011    OXA48427.1    GEZM01054789    JAV73399.1    GBBI01004032    JAC14680.1    GAMC01020552    JAB86003.1    QOIP01000009    RLU19024.1    KQ460211    KPJ16510.1    AJWK01014785    GEHC01000894    JAV46751.1    GFTR01008866    JAW07560.1    ABLF02005684    GGMS01016389    MBY85592.1    ABLF02054908    LBMM01006539    KMQ90520.1    ABLF02015610    ABLF02015611    ABLF02026843    ABLF02057498    ABLF02060119    ABLF02062416    ABLF02064495    ABLF02021176    ABLF02066403    ABLF02006304    ABLF02036268    NWSH01001014    PCG73111.1    GGMR01005535    MBY18154.1    GEHC01000865    JAV46780.1    LBMM01009210    KMQ88303.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF05380   Peptidase_A17
PF18701   DUF5641
PF00078   RVT_1
PF00665   rve
PF00008   EGF
PF00230   MIP
PF12259   Baculo_F
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF05485   THAP
PF07679   I-set
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001878   Znf_CCHC       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR000253   FHA_dom       
IPR000742   EGF-like_dom       
IPR011042   6-blade_b-propeller_TolB-like       
IPR013032   EGF-like_CS       
IPR000033   LDLR_classB_rpt       
IPR000727   T_SNARE_dom       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR022048   Envelope_fusion-like       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR006612   THAP_Znf       
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR013098   Ig_I-set       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013783   Ig-like_fold       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF81338   SSF81338       
SSF48726   SSF48726       

Ontologies

Topology

Length:
1661
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0658000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00021
outside
1  -  1661
 
 

Population Genetic Test Statistics

Pi
213.737462
Theta
208.834084
Tajima's D
0.114624
CLR
15.697426
CSRT
0.394230288485576
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号