SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12249
Annotation
PREDICTED:_uncharacterized_protein_LOC105842415_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.647
 

Sequence

CDS
ATGAGTGAGAAAGAAGAAAAGGAAAAGTACATCGAGGAATTGAGCGGTACGTTGAATCAGCAACAAGTCAATGAATTGCAATTAAGAATCGGTAAGATCGAATTATTATTTGAACAATATGACGTAGTACAAACTAAAATAGAATGCCTCGCTGACGATTTCAGCTCGCAAAGCACAGAGAGAGAAGATTTTGAATCAATTTATTACAAATCCCTTTCACAGGCTCAGGAGATTCTTTCTCGTAATTCTAAATTGTTACAAACCCAAGTGCATAGTTTTGAGGGTTGCTCTCATGTGAGTAATCATAGCCTGGTTAAATTGCCTACCATTAGTCTACCCAAATTTAATGGTTCATATAGCAACTGGCTGGAATTCCATGACACCTTCAGTAGTCTTATACATTCGAACGAGGCGATAGGAGAAATTAATAAATTTCACTACCTCAGGGCCTCGCTAGAAGGCTCTGCTGCTGTACTGCTTCAGGAGATTCAGTTCTCTGCCAGCAACTATTCTGTGGCGTGGAAGCTGTTATGTGAGAGGTACGATAATAAGCGCCTATTAATTCAAACACACGTTAATAATTTATTTAATATAGACGCAATAAAGAGTGAATCTTCGTTTAATTTAAGACGTTTCATAGATCAGCTGAATAAAAGCCTGAGAGCTTTAGAGTCGCTGGGTGAACCGACTGATCATTGGGACACTCTTCTCATCCACATGATGAGTCGTAAAATCGAACAGAAGACGCTGCGTGAATGGGAAGAGTGCAAAGGTCGTCTTGATAAAGAAAAGCCCATTTCTTTGTCCATATTTCTCGATTTCATTCGTAACCGGGCCGATCTATTAGAAACGATGGAATTTACTCGCTCTAATCTTCCTCACACACAAGTTCAGCCACCATAG
Protein
MSEKEEKEKYIEELSGTLNQQQVNELQLRIGKIELLFEQYDVVQTKIECLADDFSSQSTEREDFESIYYKSLSQAQEILSRNSKLLQTQVHSFEGCSHVSNHSLVKLPTISLPKFNGSYSNWLEFHDTFSSLIHSNEAIGEINKFHYLRASLEGSAAVLLQEIQFSASNYSVAWKLLCERYDNKRLLIQTHVNNLFNIDAIKSESSFNLRRFIDQLNKSLRALESLGEPTDHWDTLLIHMMSRKIEQKTLREWEECKGRLDKEKPISLSIFLDFIRNRADLLETMEFTRSNLPHTQVQPP

Summary

EMBL
NWSH01001945    PCG69607.1    BABH01004450    BABH01022219    BABH01022220    JTDY01001654    + More
KOB73239.1    JTDY01001855    KOB72712.1    KZ149999    PZC75356.1    KQ460211    KPJ16510.1    KQ977505    KYN02283.1    KQ459312    KPJ01687.1    JTDY01006550    JTDY01002030    JTDY01001260    KOB65898.1    KOB72276.1    KOB74365.1    KQ460205    KPJ16960.1    JTDY01006305    JTDY01002831    KOB66118.1    KOB70633.1    NWSH01001201    PCG72150.1    GALX01002843    JAB65623.1    GALX01002427    JAB66039.1    NWSH01001093    PCG72659.1    ODYU01011804    SOQ57759.1    LBMM01009058    KMQ88428.1    GAIX01014054    JAA78506.1    GALX01005110    JAB63356.1    KQ460970    KPJ10166.1    KQ977963    KYM98425.1    NWSH01000142    PCG79113.1    KQ977342    KYN03430.1    KQ460500    KPJ14270.1    GALX01004000    JAB64466.1    GEZM01055231    JAV73081.1    GGMR01011310    MBY23929.1    GGMR01004354    MBY16973.1    KQ982464    KYQ56128.1    GBHO01005506    GBHO01005503    JAG38098.1    JAG38101.1    KQ458793    KPJ04955.1    KQ981127    KYN09299.1    GBGD01000063    JAC88826.1    GDQN01003166    JAT87888.1    GGMR01014413    MBY27032.1    KK111574    EZA46352.1    KQ978056    KYM97755.1    KQ977557    KYN02007.1    ABLF02021176    ABLF02066403    KQ460545    KPJ14069.1    KQ978164    KYM96665.1    KQ977032    KYN06203.1    GEZM01018702    GEZM01018700    GEZM01018697    JAV90049.1    KQ981002    KYN10407.1    ABLF02006001    ABLF02006002    KQ973442    KXZ75531.1    KQ979016    KYN24380.1    KQ979276    KYN22031.1    RSAL01000402    RVE41913.1    KQ977959    KYM98432.1    ABLF02041505    LBMM01010061    KMQ87695.1    KQ976954    KYN06860.1    GEZM01012999    JAV92824.1    KQ981073    KYN09793.1    GBBI01004139    JAC14573.1    GBBI01004140    JAC14572.1    JXUM01252006    KQ640254    KXJ62375.1    ABLF02023723    GGMR01007417    MBY20036.1    ABLF02022040    ABLF02056888    ABLF02004142    GGMR01020322    MBY32941.1    KQ982204    KYQ59009.1    GEZM01086714    JAV59026.1    GBHO01015021    JAG28583.1    ABLF02042264    KQ414692    KOC63604.1    LBMM01003740    KMQ93188.1    ABLF02023842    ABLF02028949    ABLF02058391    ABLF02013385    ABLF02029502    ABLF02029511    GG695382    EFA13346.1    GGMS01001896    MBY71099.1    GGMS01000724    MBY69927.1    GGMR01003885    MBY16504.1    GGMR01018506    MBY31125.1    GEZM01086715    JAV59020.1    KQ978343    KYM95005.1    KQ978502    KYM93420.1    ABLF02006985    KQ982064    KYQ60564.1    KQ978679    KYN29321.1    KQ980852    KYN12196.1    ABLF02026305    KQ980737    KYN13736.1    KQ981142    KYN09177.1    GBBI01004032    JAC14680.1    ABLF02016109    ABLF02016113    GGMR01020500    MBY33119.1   
Pfam
PF03564   DUF1759        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF02201   SWIB
PF07679   I-set
PF02945   Endonuclease_7
Interpro
IPR036397   RNaseH_sf        + More
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR001878   Znf_CCHC       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR003121   SWIB_MDM2_domain       
IPR036885   SWIB_MDM2_dom_sf       
IPR019835   SWIB_domain       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR013098   Ig_I-set       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013783   Ig-like_fold       
IPR038563   Endonuclease_7_sf       
IPR004211   Endonuclease_7       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF47592   SSF47592       
SSF48726   SSF48726       

Ontologies

Topology

Length:
300
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00215
Exp number, first 60 AAs:
0
Total prob of N-in:
0.07656
outside
1  -  300
 
 

Population Genetic Test Statistics

Pi
228.854662
Theta
179.2254
Tajima's D
0.904296
CLR
0.147838
CSRT
0.632168391580421
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号