SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12248
Pre Gene Modal
BGIBMGA000917
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Microplitis_demolitor]
Location in the cell
Nuclear   Reliability : 4.594
 

Sequence

CDS
ATGTTTACAAAAGCACGCAGCAACTCACTCGGTACTATACCGCAAGACATCAACGTCCCTGAAATAATATTTAGTACGAAAGATCAAATCAAGCACGACTGGCAACAGGACAGAATTCCGCCAGCCAAAAGAAAGAGAGTGGAAACCGACTCCCCACAGACTGAAAAGGTAAAGAAAAAGCCTAACACAACCACTTATGCAATTACTACAAAGAATCAATTCGATATTTTAGACAGTGAGGAATCTACAACAGACAATATAGAAATAGAAAAACCACCAAAACCAGAACCAATATTTGTTACTGGTGTCCTGGATATCAGCGCCCTCCGAAATAAATTAAAAGAAATTGCATCAGCAGACGACTACACTATGACAACACTCAAGTCAGGACACATTGTGAAAATAATGCCAGCAAACAACTTAATTAATTCAAACGAACCGCTTCAAGTGCAACAACTGGGTGACATCCTGGATAAGATGTTCAACAGAATTCAAACCATGATGATCAACATGGTAGACAACATGATGGACAGTGTGGAATCTGACTTAGATCTCACATCAGACCATTCTGCAGTTATTCTTAACCTGAATAATAAGATAATATTAAATGATGCACCACCCAGAATCTACAATAAAAAAACAAACTGGGAAGAATACAAAAATATTATCACAGCAGAAGTACAGCTCATGGTGTCACTGAAAACAGTAGAAGAAGTTGAACAAGCCATTGAAAACCTAAATGGTTTGATCCATAGCGCAGCTAATAGGTCCACACCCCAAGGTAAAGCTAGTAGTGTTAAAGAGCATGTATACCCTGCGTTCATTAGGGACAGAGTAACTGAAAGACGTCGACTCCGCAGAGAATGGCAAAACAACCACTACAAAAGAGACAAAACTGCTTTTAATAAAGCATCGCAACAACTACAGGCGCTAACGAAACAATGGGCAAATGAGAACTTACAGAGTTACCTCACAAATCTGACACCTACTAGTAACACAAATTACTCTCTGTACAAAGCTACAAAAAACATGAAGCGTCCAAAACAACAGGCTACACCTATAAAAACACAACTAGGGACCTGGGCTCGCTCCGACGGTGAGAAAGCTACTACATTTGCAGAGCATTTACAAAAAGTATTTGAGCCACCTCCTAGCAACGACCAAAGCCTAGACAATGAAATAGACGAATACTTAAGTTCTCCAAATCAGATGTGCCTACCGTTGAAACATGTCACGCTTAATGAACTAAGACGGGACATCCGAAAACTTAAACAAGAAGTGGTTGCGATTTGGCATGGTCGCTTAGAAGTTGTAGCTTTATAA
Protein
MFTKARSNSLGTIPQDINVPEIIFSTKDQIKHDWQQDRIPPAKRKRVETDSPQTEKVKKKPNTTTYAITTKNQFDILDSEESTTDNIEIEKPPKPEPIFVTGVLDISALRNKLKEIASADDYTMTTLKSGHIVKIMPANNLINSNEPLQVQQLGDILDKMFNRIQTMMINMVDNMMDSVESDLDLTSDHSAVILNLNNKIILNDAPPRIYNKKTNWEEYKNIITAEVQLMVSLKTVEEVEQAIENLNGLIHSAANRSTPQGKASSVKEHVYPAFIRDRVTERRRLRREWQNNHYKRDKTAFNKASQQLQALTKQWANENLQSYLTNLTPTSNTNYSLYKATKNMKRPKQQATPIKTQLGTWARSDGEKATTFAEHLQKVFEPPPSNDQSLDNEIDEYLSSPNQMCLPLKHVTLNELRRDIRKLKQEVVAIWHGRLEVVAL

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Length:
440
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00038
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00691
outside
1  -  440
 
 

Population Genetic Test Statistics

Pi
269.541688
Theta
192.142715
Tajima's D
1.264073
CLR
18.993749
CSRT
0.730813459327034
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号