SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12247
Annotation
PREDICTED:_uncharacterized_protein_LOC106708887_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.723
 

Sequence

CDS
ATGTCGGTGTCCTACATTCGCGGGAAGGTGACTAGTGAGCTCCGATGGTTCGCATCAGCTCATGCTTTGGTTGACAGAACAGATAGGGATGCGGCATTGCTCGATAGGGCGTCTCAGGTGCACGGACGGTTGGAGGTAGTGTACGATCGGTTGTCTGACCTCGTTGCTTTGGGGTCCGAAGTGGAGAAGGAGGTGATCCATGCCATCAGTCTTGACGTGGACCAGTGTCAGGAGTACGCTGATGCCATTCTGCAACGGGTGGCCGATATTAAGAAGCAGTCGTCTTCCGGTGGTAATGGAGGTTCGGGAACTTCGTCAGGCGTCATATCACGCCTCCCCTCCATCGACCTGCCGATCTTCCACGGTGATCTGAACGAGTGGGTCGGCTTTATTAATTTGTTTGACAGCCTGGTCCATGGTCGGTCGGACTTGACTGCCTCTTATAAGATGGCTCAGCTTCGGGGTGCTCTGCGAGGTGAACCTGGTGAATTGGTGGCACACTTGCCTATCACCAACGACAATTATGCGGTCGCACGCCAGATCCTGTTCGACCGATATCAAAATCAACGACGGTTGGTGGACGCTCAGCTGGCCAGGCTGTTTGCGATACCAAAACTTTCTCGGGCTTCCGATATCAGAGCCGAGGTACTGAATCCAGTTACGGTGGCCACTAAGGCCTTGGGCAATTTGGGTCTACCAGTAGACCAATGGTCATATCTGCTCTTTTATATTGTTGCAGGTAGGCTGCCGGTTGAGGTGCTCACTCGCTTCGAGCAGCAGGACAACGCAGGTAGGGACGAACTGCCTACCCTGGCCAATCTGCTGGCATTTTTAGAAGCCGAAAGTCGCAGACACGAGATTATGCCACCACCCTCCTCCTCTGGGTCGCGTGTGCCGGCTTCCGGCCACGCCGTTTCGGTTGCTCAGAGGGGAGGGGGAGGGGATAAGAGGGGGCCGTCTCAACGACTGACTGCGCTCATGGCAGCGGTGGGAGGCTCACGGTGTGCCTTCTGTCATGAGAGCGGGCACGACGTAGCCGCCTGTCCGAGGTTCCGGTCGACGCGCATCAGGGGTAGACGCAACATCGTTGCCCAGCGGCGATGGTGCTTTTTTTGTTTTGGGCCGCACACGGCGAGCGTCTGTCCACAGCCACAATTGTGCCCTAATTGCGACGGTCGGCACCATGCCCTCCTGTGTCTGGAGTCTGCCGCCACTCCGAGGTCATCCGGACGCAGTCATCCAGCCTCGCCGACCGGTGAGCGCACCGGTCGTAGCCCTCGCCAATTCGGCGGCGTGAACCCTCGGAAAGAGGCTTCGCAGGGAGGCGCCGGGTTAGAAGCTGTTTTACTTCCTACCGCTTCTGTTCGGGTGTTGGATTCGGATGGCAACACTGTGTTTGCTCGAGCTCTGTTGGATTCCGGCGCACAGGGCACTATTATGTCGAGCAACCTTGCAGTACGGTTGGGCAATCCTATTTACAAGTCTTCTTATTCTATTCGTGGAGTGGGCAATGTTAGAATTTCGGACGTGATCGGTCACACTTCATTTATTTTCTCATCGAATCCCAACCCTCGCTTACAGTTTAGAGTCTCAGCTTTGGTGATGCCTGAGGTGATAGGTCGTCACCCTCCGGTGAAGGTAAACAGTTACATACGGTCATTGACTTCAGACTTACGGCTAGCGGACCCCAAGTTTGACACCCCGGGGCCAGTAGACGTACTACTTGGGGCGGATGTACTAGGGAAGCTGCTCCTGACTGGGAAGCGCGTTCTTCATGCGGAGGGTTTGGTTGCAATGGACACAAAATTAGGGCATGTATTGTTGGGTCCTGCGTTCCGGCCGGTCGCTGCGAGGAAATCGGACAATTTTCTGGTCGGGTCTACGCTTTCGGAAGTAGTCCAACGGTTTTGGGAACTAGAAGAACCTCCTACAGCTTATCGAGTTAACCCGGATGAGGAGGAATGTGAGCTGTTTTACCAGAATAATACGGGTCGTCTCTATTCGGGCCGGTTCTTGTTAAGACTTCCTTTTCGGGCGAATCGCCCACTGCTAGGCAGTTCGAGGAAGGCAGCAGAGACCAGACTTTTGTCAATGGAGAGACGCATGAGGCGCGACGCGGTGTTCCGGCAGAAATATGTAGAGTTTATGCGGGAGTATGAATCTTTAGGTCACATGTCGGTTTCCAAGGTAGATTGGAGTGCTACGGAGCACTGTTTCCTGCCTCATCATGCGGTTTTGAAAACTCCTAACGGTAAAATTAGGGTCGTGTTTGACGGTTCGGTCACGACCTCCTCCGGCGTCTCCTTAAATCAGTGTCTCCATTCGGGTCCAAAGCTGAACCGGGACATTTCAGACATACTGACGAGCTTCCGCAGGCACCAGATCGTTTTCGTGGCAGACATCCGTATGATGTTCAGGCAAACGGTGATTCATCCGGAGGATAGGCGGTATCAACTCATTCTCTGGCGTGAAAGCTCAGATGAGCCCATAAAAATTTATGAACTGAACACGAACACTTACGGGTTGCGGTCGAGTCCATATTTAGCGGTTCGTTCTTTGCGGGAGTTGGCAGTGAGGGAACGGTTGCACTACCCTCGTGCTGCGGACATTTTGGAACGGGACCTATATGTCGATGACGTATGTACGGGCGCCGACAGTGTCGAAGAGGCCTTATCACGCAAGGATGAACTGATCCGCCTTTTGAGCAGGGGCGGGGATTCAATATCGTCCGATTCAAGACGAATTTACCTATCGGGTGGAGTTGGAAAATCCAAAGGTATGGTCTAA
Protein
MSVSYIRGKVTSELRWFASAHALVDRTDRDAALLDRASQVHGRLEVVYDRLSDLVALGSEVEKEVIHAISLDVDQCQEYADAILQRVADIKKQSSSGGNGGSGTSSGVISRLPSIDLPIFHGDLNEWVGFINLFDSLVHGRSDLTASYKMAQLRGALRGEPGELVAHLPITNDNYAVARQILFDRYQNQRRLVDAQLARLFAIPKLSRASDIRAEVLNPVTVATKALGNLGLPVDQWSYLLFYIVAGRLPVEVLTRFEQQDNAGRDELPTLANLLAFLEAESRRHEIMPPPSSSGSRVPASGHAVSVAQRGGGGDKRGPSQRLTALMAAVGGSRCAFCHESGHDVAACPRFRSTRIRGRRNIVAQRRWCFFCFGPHTASVCPQPQLCPNCDGRHHALLCLESAATPRSSGRSHPASPTGERTGRSPRQFGGVNPRKEASQGGAGLEAVLLPTASVRVLDSDGNTVFARALLDSGAQGTIMSSNLAVRLGNPIYKSSYSIRGVGNVRISDVIGHTSFIFSSNPNPRLQFRVSALVMPEVIGRHPPVKVNSYIRSLTSDLRLADPKFDTPGPVDVLLGADVLGKLLLTGKRVLHAEGLVAMDTKLGHVLLGPAFRPVAARKSDNFLVGSTLSEVVQRFWELEEPPTAYRVNPDEEECELFYQNNTGRLYSGRFLLRLPFRANRPLLGSSRKAAETRLLSMERRMRRDAVFRQKYVEFMREYESLGHMSVSKVDWSATEHCFLPHHAVLKTPNGKIRVVFDGSVTTSSGVSLNQCLHSGPKLNRDISDILTSFRRHQIVFVADIRMMFRQTVIHPEDRRYQLILWRESSDEPIKIYELNTNTYGLRSSPYLAVRSLRELAVRERLHYPRAADILERDLYVDDVCTGADSVEEALSRKDELIRLLSRGGDSISSDSRRIYLSGGVGKSKGMV

Summary

EMBL
LBMM01008464    KMQ88855.1    LBMM01011051    KMQ87060.1    GEBQ01004229    JAT35748.1    + More
LBMM01010405    KMQ87487.1    LBMM01007859    KMQ89359.1    ABLF02030698    ABLF02030705    ABLF02030709    GGMS01014443    MBY83646.1    ABLF02008594    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GALX01005110    JAB63356.1    LNIX01000007    OXA51795.1    ABLF02008032    ABLF02035293    ABLF02060940    GGMR01017784    MBY30403.1    ABLF02002658    ABLF02034765    ABLF02042453    LNIX01000016    OXA46198.1    GGMR01010723    MBY23342.1    ABLF02041614    GGMS01010524    MBY79727.1    KK114194    KFM61875.1    LNIX01000026    OXA42254.1    ABLF02035780    GEHC01000869    JAV46776.1    GEBQ01025225    JAT14752.1    ABLF02054908    ABLF02028666    ABLF02066713    GGMS01012379    MBY81582.1    ABLF02005684    RSAL01001808    RVE40681.1    GGMR01011131    MBY23750.1    ODYU01012875    SOQ59395.1    LBMM01006490    KMQ90572.1    GEZM01054766    GEZM01054765    JAV73410.1    GEHC01000939    JAV46706.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    GEHC01000864    JAV46781.1    ABLF02008636    ABLF02065931    ABLF02021785    GGMS01014951    MBY84154.1    GGMR01002421    MBY15040.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEZM01060253    JAV71158.1    ABLF02025193    GEHC01000946    JAV46699.1    GEZM01060254    JAV71154.1    ABLF02034704    ABLF02034708    ABLF02034709    ABLF02044644    ABLF02055319    ABLF02008319    ABLF02008320    GBBI01004479    JAC14233.1    LBMM01009746    KMQ87900.1    LBMM01009898    KMQ87805.1    GGMR01006575    MBY19194.1    LBMM01015575    KMQ84755.1    LNIX01000005    OXA54553.1    OXA54559.1    ABLF02030854    ABLF02067347    GGMR01003717    MBY16336.1    LNIX01000036    OXA39969.1    LNIX01000018    OXA45284.1    CR954257    CAJ14165.1    ABLF02041650    GEZM01054789    JAV73399.1    ABLF02018732    ABLF02018737    LBMM01010417    KMQ87475.1    LBMM01009888    KMQ87813.1    ABLF02008635    ABLF02023121    ABLF02065930    GGMR01020500    MBY33119.1    LBMM01012568    KMQ86144.1    GGMR01009860    MBY22479.1    ABLF02006784    ABLF02009462    ABLF02065929    ABLF02028302    ABLF02041631    OXA54454.1    ABLF02028417    ABLF02042407    LBMM01009284    KMQ88248.1    ABLF02022040    ABLF02056888    LBMM01012708    KMQ86040.1    ABLF02005251    ABLF02055296    LNIX01000063    OXA37200.1    GAMC01003146    JAC03410.1    GGMR01002024    MBY14643.1    ABLF02023842    ABLF02028949    ABLF02058391    ABLF02006304    ABLF02036268    GGMR01013370    MBY25989.1    ABLF02026240    ABLF02055027    ABLF02003339    ABLF02058001    GGMS01012504    MBY81707.1    ABLF02041762    GGMS01014133    MBY83336.1    GGMR01016460    MBY29079.1    GBHO01006408    JAG37196.1   
Pfam
PF05380   Peptidase_A17        + More
PF18701   DUF5641
PF03564   DUF1759
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00078   RVT_1
PF00665   rve
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF13843   DDE_Tnp_1_7
Interpro
IPR040676   DUF5641        + More
IPR008737   Peptidase_asp_put       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR036875   Znf_CCHC_sf       
IPR029526   PGBD       
IPR017907   Znf_RING_CS       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
928
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01269
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00063
outside
1  -  928
 
 

Population Genetic Test Statistics

Pi
296.208331
Theta
174.8062
Tajima's D
1.874929
CLR
0
CSRT
0.857357132143393
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号