SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12236  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA014192
Annotation
PREDICTED:_myrosinase_1-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.363
 

Sequence

CDS
ATGAATCTCTCGTGGCAAGTCGCGTTCAGCGCGCTGATGGCTTGCGCCTGGGGGTCGGATCTAACCTTCCCTCCTGGGTTCAAGTTCGGTGCTGCATCAGCGGCATACCAGATTGAAGGCGGATGGAATGCAAGCGATAAAGGAGAAAGCATATGGGATCGTCTTGTCCATGAAAATCCTGAGATGATAGGGGATCGCAGTAACGGAGACGTGGCCTGCGACTCTTACCATCTCTGGCAGAGAGACATAGAAATTGCATCAGAAATCGGTCTACACTTCTATCGATTCTCTATAGCGTGGACGAGAATTCTACCAACCGGCTTCAGTGATAAGATCAGTGAAGACGGAAAGAATTACTACAATAGACTGATTGATGGGCTGTTGGAGAAAGGGATCAATCCAGTAATTTCAATTTACCACTGGGATCTGCCGCAACAGTTGCAAGACTTGGGTGGCTGGGTAAATCCTCTCATAGTTGACTGGTTCTCTGATTACGCAAGGGTCGTATTCTCTCTATACGCGGACAGAGTGAAGACCTGGATCACCATCAATGAGCCTACTATGATCTGCGATGAATCTTACAACACTGGTTTCTTTGCCCCAGCGATTTTGGAGCCCCATATATCCCCCTATGTATGTGCAAAGAACGTTTTGCTTGCCCATGCTAAGGCTTGGAGGATTTACGACGAGGAATACAGACCAAAGTACAACGGCGAAATAACCTTAGCCAATCATTTGATCTGGTATGAACCTCTGGGTGAAGAAGACTTCGAACTCACTGAATTAGTCCGGCAAAATTTGGTTGGTCGATACTCTCATCCGGTTTATTCAAAGGAGGGAGGTTGGCCGCCATCGCTCGAAAAACACATGGAAGAGGTCAGCAGACGGAAAGGTTTCCAGAGATCAGTCCTGCCTCCTTTCACTCGAGAAGAGATTGACTTAGTAAAAGGCACCTTCGATTTCTACGCCATGAACCATTACACCAGTCGCCTAGTTCGGAAAGCTGAGCCAAGCGAACACATCGGCTCGTTCCCATTGAACGGAGCTCCTGATCTAGAAGCTGTCTTCGAAAAAGACCCGAGTTGGAGCATTACGACTTCCCATTGGTTCTATATTAACCCCGAAGGTATTCGACGGCAGCTGGCCTGGTTGAGGAAAGAGTACGGAGACATCAAATTCTGGATCACAGAAAACGGCTTGTCGACTACCAGCGGCCTAGAAGACAGAGAACGAATCGAATTCTACAGGGATTATCTGAAAGAGGTGCTCCTGGCCATCAACGAGGACGGTCAAAAAGTGACGGGTTACACAGCGTGGACTCTGATGGATAATTTCGAGTGGAACGACGGTTACAATTCGAAATTCGGATTATACGAAGTGAACTTTACTTCCCCGATGCGCACCAGAAGACAACGCGCCTCCGCCCGCTATTACAAGCAGATCATCGACACACATTCAGTACCAAAGAGTCCTTATGACGACCTATGA
Protein
MNLSWQVAFSALMACAWGSDLTFPPGFKFGAASAAYQIEGGWNASDKGESIWDRLVHENPEMIGDRSNGDVACDSYHLWQRDIEIASEIGLHFYRFSIAWTRILPTGFSDKISEDGKNYYNRLIDGLLEKGINPVISIYHWDLPQQLQDLGGWVNPLIVDWFSDYARVVFSLYADRVKTWITINEPTMICDESYNTGFFAPAILEPHISPYVCAKNVLLAHAKAWRIYDEEYRPKYNGEITLANHLIWYEPLGEEDFELTELVRQNLVGRYSHPVYSKEGGWPPSLEKHMEEVSRRKGFQRSVLPPFTREEIDLVKGTFDFYAMNHYTSRLVRKAEPSEHIGSFPLNGAPDLEAVFEKDPSWSITTSHWFYINPEGIRRQLAWLRKEYGDIKFWITENGLSTTSGLEDRERIEFYRDYLKEVLLAINEDGQKVTGYTAWTLMDNFEWNDGYNSKFGLYEVNFTSPMRTRRQRASARYYKQIIDTHSVPKSPYDDL

Summary

Similarity
Belongs to the glycosyl hydrolase 1 family.
Belongs to the class-I aminoacyl-tRNA synthetase family.
EMBL
BABH01035838    BABH01035839    KZ150152    PZC72823.1    ODYU01001752    SOQ38385.1    + More
PZC72822.1    NWSH01005512    PCG64155.1    NWSH01002416    PCG68339.1    KQ459053    KPJ04240.1    RSAL01000405    RVE41892.1    ODYU01006661    SOQ48703.1    KPJ04243.1    BABH01035825    KPJ04242.1    MG992371    AXY94809.1    NWSH01004417    PCG65145.1    PZC72820.1    PZC72831.1    BABH01035833    BABH01035834    BABH01035835    BABH01035826    BABH01035827    ODYU01009444    SOQ53875.1    SOQ53877.1    KPJ04241.1    BABH01035816    BABH01035817    KQ461157    KPJ08092.1    KQ460779    KPJ12242.1    KQ459598    KPI94624.1    JN033714    AEW46867.1    RSAL01000077    RVE48784.1    ODYU01012291    SOQ58525.1    KPI94627.1    DS232013    EDS31873.1    ODYU01004836    SOQ45125.1    CH477568    EAT38910.1    JXUM01040979    KQ561266    KXJ79157.1    APCN01002262    GBUI01000001    JAI18234.1    AAAB01008960    EAL40075.2    CH478582    EAT32750.1    EAA11668.3    KPJ12243.1    BABH01014157    AGBW02009344    OWR51063.1    AGBW02008847    OWR52397.1    JN033728    AEW46881.1    GFDF01005306    JAV08778.1    BABH01035726    AGBW02010585    OWR48224.1    JN033718    AEW46871.1    RSAL01000019    RVE52748.1    OWR52398.1    KQ459589    KPI97521.1    NWSH01000598    PCG75431.1    JXUM01031352    KQ560919    KXJ80348.1    ODYU01004975    SOQ45390.1    EAT38908.1    ADMH02000892    ETN64735.1    GFDF01005304    JAV08780.1    GFDL01004884    JAV30161.1    GFDF01005305    JAV08779.1    JXJN01024604    JXJN01024605    JXJN01024606    ODYU01001971    SOQ38904.1    KPJ12247.1    KPI94629.1    KZ149936    PZC77130.1    GALX01004592    JAB63874.1    KQ459875    KPJ19634.1    NEVH01021237    PNF19655.1    KQ971326    EEZ97373.2    ETN64736.1    LJIG01003002    KRT83938.1    NWSH01000819    PCG74065.1    EAT38907.1    KPI94633.1    BABH01005438    KPI94632.1    KPJ12246.1    EDS31871.1    KPJ12249.1    GEZM01098374    GEZM01098373    JAV53905.1    KP068693    AJE75664.1    GBUH01000007    JAO03635.1    ETN64737.1    GFDL01002519    JAV32526.1   
Pfam
PF00232   Glyco_hydro_1        + More
PF00501   AMP-binding
PF13193   AMP-binding_C
PF00133   tRNA-synt_1
Interpro
IPR017853   Glycoside_hydrolase_SF        + More
IPR001360   Glyco_hydro_1       
IPR033132   Glyco_hydro_1_N_CS       
IPR018120   Glyco_hydro_1_AS       
IPR000873   AMP-dep_Synth/Lig       
IPR025110   AMP-bd_C       
IPR002300   aa-tRNA-synth_Ia       
IPR014729   Rossmann-like_a/b/a_fold       
IPR001412   aa-tRNA-synth_I_CS       
IPR009008   Val/Leu/Ile-tRNA-synth_edit       
IPR002301   Ile-tRNA-ligase       
SUPFAM
SSF51445   SSF51445        + More
SSF50677   SSF50677       
Gene 3D
PDB
5CG0     E-value=5.39007e-116,     Score=1069

Ontologies

Topology

SignalP
Position:   1 - 18,         Likelihood:  0.981244
 
 
Length:
495
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.895589999999998
Exp number, first 60 AAs:
0.89381
Total prob of N-in:
0.04605
outside
1  -  495
 
 

Population Genetic Test Statistics

Pi
26.31266
Theta
197.677613
Tajima's D
0.064221
CLR
0.273766
CSRT
0.388780560971951
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 QIIDTHSVPK 100.00 7e-04
25860555 NGAVIDR 100.00 7e-04
27102218 SVIPPFTREEIDIVK 100.00 7e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号