SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12233
Pre Gene Modal
BGIBMGA014191
Annotation
PREDICTED:_myrosinase_1-like_[Papilio_xuthus]
Location in the cell
Lysosomal   Reliability : 1.938
 

Sequence

CDS
ATGCTTGTAGAACTAGGCGTACACTTTTATAGGTTCTCAATATCCTGGCCACGAGTTCTGCCCACCGGTTTTCCAAACTACATCAGCGAAGATGGAGTTAAATATTATAATACTTTGATAAATGCGTTGTTGGAAAACGGAATAGAGCCCTTGGTTACTTTGTACCATTGGGACCTTCCACAGAGACTCCAGGACTTAGGAGGCTGGACGAATCCTCACATCGCAGAATGGTTCGAAAATTACGCCAGAACAGCCTTCGAGTTATTTGGCGACAGAGTGAAGACTTGGATCACGATTAATGAGCCTTTCGTCGTTTGCGACATGGCGTACAACACTGGTCTGGTGGCTCCTGGGATCATTGATCCTGAAATTGCACCATATCTGTGCAATAAATACACGTTGATGGCCCACGCGAGAGCCTGGAGACTTTACGATAAGGAGTTCAGACATAAATATCATGGTAAAATCTCCATCGCGAACCAATTGTTTTGGTTTCAGCCTCTTACTGATGAAGATAAAGAAGTCACTGAACTAGCATTGGAGAATTGTGTCGGTCGGTACTCTCATCCAATTTACTCTAAGAAAGGTGGATGGCCGCCGAGCATAGAGAAAACTATCCATGACAATAGTCGAAGACAAGGGTACCTGAAGTCAAATTTACCCGTTCTGACTAAGCAAGAGATTGAGTACATCAAGGGTACCTATGACTTCTTTGGACTGAATCACTACACAAGTCGCTTGGTCCGAAAAGCCGAGACTGGCGAGAAGCTGAGTCCCTGGCCCATAGGGGATGCTCCTGATTTCGATGCTCGACTTCTAGTTTCGCCGCACTGGCCCAAGACTTCATCTTCTTGGTTTTTTGTCAACCCACCAGGGATAAGAAAACTGCTGCAGTGGTTGAAGAAAAATTACGGCGATCTTACAGTTTTAGTAACGGAAAACGGATTTCCGAATCTTGGTGGCGTGGAGGATGTTGACCGAATAAACTATTACAGAGATAATATGCATGAGATTCTCCTGGCTATCAAAAAAGACAAAATCAACGTAACCGCATACACGGCTTGGACGCTGATGGACAACTACGAATGGATGGATGGATACAAGTGA
Protein
MLVELGVHFYRFSISWPRVLPTGFPNYISEDGVKYYNTLINALLENGIEPLVTLYHWDLPQRLQDLGGWTNPHIAEWFENYARTAFELFGDRVKTWITINEPFVVCDMAYNTGLVAPGIIDPEIAPYLCNKYTLMAHARAWRLYDKEFRHKYHGKISIANQLFWFQPLTDEDKEVTELALENCVGRYSHPIYSKKGGWPPSIEKTIHDNSRRQGYLKSNLPVLTKQEIEYIKGTYDFFGLNHYTSRLVRKAETGEKLSPWPIGDAPDFDARLLVSPHWPKTSSSWFFVNPPGIRKLLQWLKKNYGDLTVLVTENGFPNLGGVEDVDRINYYRDNMHEILLAIKKDKINVTAYTAWTLMDNYEWMDGYK

Summary

Similarity
Belongs to the glycosyl hydrolase 1 family.
Belongs to the class-I aminoacyl-tRNA synthetase family.
EMBL
BABH01035833    BABH01035834    BABH01035835    NWSH01002416    PCG68339.1    KZ150152    + More
PZC72823.1    ODYU01001752    SOQ38385.1    ODYU01006661    SOQ48703.1    PZC72822.1    NWSH01005512    PCG64155.1    KQ459053    KPJ04240.1    KPJ04242.1    BABH01035838    BABH01035839    MG992371    AXY94809.1    KPJ04243.1    BABH01035825    BABH01035826    BABH01035827    RSAL01000405    RVE41892.1    PZC72831.1    NWSH01004417    PCG65145.1    JN033711    AEW46864.1    ODYU01009444    SOQ53877.1    SOQ53875.1    KPJ04241.1    PZC72820.1    KZ150122    PZC73162.1    KQ461157    KPJ08090.1    BABH01035811    BABH01035812    KPJ08092.1    AGBW02008370    OWR53561.1    ODYU01004975    SOQ45390.1    KQ460779    KPJ12242.1    KQ459598    KPI94624.1    GFDL01004884    JAV30161.1    ODYU01001184    SOQ37050.1    GEDC01005540    JAS31758.1    GEDC01016220    JAS21078.1    LJIG01003002    KRT83938.1    DS232013    EDS31873.1    NWSH01001829    PCG69984.1    RSAL01000077    RVE48784.1    AAAB01008960    EAL40075.2    AB508960    BAI50024.1    APCN01002262    JN033728    AEW46881.1    ODYU01012291    SOQ58525.1    GU591172    ADD92156.1    BABH01035816    BABH01035817    GEZM01098374    GEZM01098373    JAV53905.1    BABH01014157    JXUM01012550    JXUM01012551    JXUM01012552    KQ560357    KXJ82853.1    AGBW02009638    OWR50268.1    AGBW02014221    OWR42063.1    AB508954    AB508956    BAI50018.1    BAI50020.1    KPI94631.1    AB508955    BAI50019.1    JN033714    AEW46867.1    AB508957    BAI50021.1    CH477568    EAT38910.1    AXCN02000455    AB508959    BAI50023.1    GGFM01006254    MBW27005.1    KQ459589    KPI97521.1    GGFJ01004382    MBW53523.1    CH478582    EAT32750.1    ADMH02000892    ETN64738.1    BABH01035821    AGBW02011758    OWR46178.1    AGBW02008847    OWR52397.1    KPJ12247.1    OWR52398.1    NEVH01021237    PNF19653.1    JXUM01031352    KQ560919    KXJ80348.1    AB073638    BAB91145.1    KC891004    AGS32242.1    PZC73163.1    GQ911585    ADB23476.1    RSAL01000018    RVE52880.1    KPJ12243.1    KQ459144    KPJ03612.1    KPJ08091.1    AB508958    BAI50022.1    BABH01005437    KPI94627.1    ODYU01004836    SOQ45125.1    JN033727    AEW46880.1    HM152540    ADK12988.1    AJWK01004788    AJWK01004789    AJWK01004790    KQ971326    EEZ97373.2    GEZM01089030    GEZM01089029    JAV57758.1    AGBW02009344    OWR51063.1    BABH01005438    NEVH01024540    PNF16838.1    KU886065    AMY26906.1   
Pfam
PF00232   Glyco_hydro_1        + More
PF00501   AMP-binding
PF13193   AMP-binding_C
PF00133   tRNA-synt_1
PF01557   FAA_hydrolase
Interpro
IPR033132   Glyco_hydro_1_N_CS        + More
IPR001360   Glyco_hydro_1       
IPR017853   Glycoside_hydrolase_SF       
IPR018120   Glyco_hydro_1_AS       
IPR000873   AMP-dep_Synth/Lig       
IPR025110   AMP-bd_C       
IPR002300   aa-tRNA-synth_Ia       
IPR014729   Rossmann-like_a/b/a_fold       
IPR001412   aa-tRNA-synth_I_CS       
IPR009008   Val/Leu/Ile-tRNA-synth_edit       
IPR002301   Ile-tRNA-ligase       
IPR011234   Fumarylacetoacetase-like_C       
IPR036663   Fumarylacetoacetase_C_sf       
SUPFAM
SSF51445   SSF51445        + More
SSF50677   SSF50677       
SSF56529   SSF56529       
Gene 3D
PDB
3VII     E-value=1.20238e-92,     Score=867

Ontologies

Topology

Length:
368
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00772999999999999
Exp number, first 60 AAs:
0.00414
Total prob of N-in:
0.00237
outside
1  -  368
 
 

Population Genetic Test Statistics

Pi
200.521211
Theta
131.873578
Tajima's D
1.332427
CLR
0.436804
CSRT
0.741412929353532
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号