SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12232
Pre Gene Modal
BGIBMGA007548
Annotation
PREDICTED:_uncharacterized_protein_LOC105841862_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.462
 

Sequence

CDS
ATGAGTGAGCCTTGTGATGGAGTTGGTGGCGTCAGTTTATCTGACGTCACCTTTTCCAAAAATTCTCCGGAGGTCGGTGCGCCGTCATCAGAAGTGGGATCACCTCCCACTTCTGCTCGCCCTTCTGGCTCGGTTAACAAAAATATGAACACTTCTGTTGATGGGGTGCCGGCTGATTTTTTCACTCAGATGTTGCAAATGATGAAACACGTGTCGGATCGTATGACGTCGCAATCAGATATTTCAAAAGTGAGAATAAATGACGTGTTTTTGCCGTCATACGATCCAGACGCTAATGTTGGGGTTAGAGAATGGTGTCAACATGTGACCACAGCTATGGAAACTTACAACCTGAGCGATTATGAAGTCCGGATGAAGGCTGGTAGTTTGCTTAAGGGTCGCGCAAGGTTGTGGGTTGACAATTGGCTGGTGTCCACCACCACGTGGCAAGAATTGCGTGATGTTTTAATTTCGACTTTTGAACCGGAAAACCGATATTCACGCGATGTTGTGCGTTTTAGAGAACATACTTACGATAATTCTAAAGACATCGCTCAGTTCTTATCACAAGCTTGGGTTTTATGGAGACGTATTACTAAAGATAAGTTGTCGAATGATGACGCGGTTGAGGCTGTTATCGGTTGCATTGGGGATGAGCGCCTGAGAATCGAACTGTTAAATGCGCGAGCTACGTCTGTCCCAGAACTTATTTCAGTGGCCTCATCTATAAAAAGTGTTAAACGTCCTCATCCCAATGCATCGATACCGCATCAGAGTGTCGCAAAGCGCCCACGTTTTGATAAGACACCGAGCTTTTGCCAAATCTGTAAAAGGTCGGGTCACGATACGCGTGATTGCCGATACCGCGACAAACCTGAAGGCCCTCAGCCGCGACAACAGGATGGTAAAACTACTCCTCCAGGTGTTGGTAGACCGACATACCAAATAGACCAACTGGCCGGGGGTATTTATTTCACCACAATTGACATGGCAGCTGGGTTTCATCAGATACCTATTTCGGAGGGATCAATTGAAAAGACTGCTTTTGTAACTCCCGATGGTTTATATGAATACCTAACTATGCCATTTGGACTTTGCAACGCAGTGTCAGTCTACCAGCGCTGCATTAATAGGGCTCTCGCTCACCTCACGAGCTCACCAGACCAAGTGTGCCAGGTCTATGTCGATGATGTGCTCTCAAAGTGTAAAGATTTTGATCAGGGCTTATCCCATATTGAACGAATATTGATTGCTCTACAAGAAGCTGGCTTTTCTATTAACGTTGATAAAACCGCCTTCTTTAAACGCTCCATCGAGTACTTGGGCAATATAATTGCCGACGGGCAGGTCAGCCCTAGCCCAAGAAAGGTGGAGGCTTTAACGAAGGCACCAATCCCGAAAACTGTCAAACAAGTTAGACAATTCAATGGCCTGGCTGGATATTTCAGACGTTTCATTCCCAACTTCTCGCGAGTTATGGCGCCTTTATATGAACTCACTAAGAACGATACGACATGGGAATGGAACGAAAGGCATGACGAAGCTAGGGATTATATTGTCAAACATCTGTCTACTGCGCCTACCCTTACGCTATTCCAGGAAGACGCACCCATCGAACTCTACACGGACGCCAGCAGCATCGGCTACGGGGCAGTGTTAGTGCAGACATTCGCGGGTCGCCAACATCCAGTCGCGTACATGAGCCAGCGCACCACCGACGCCGAGAGCCGCTACCACTCTTACGAACTTGAAACGTTGGCGGTCGTAAGAGCAATTAAGCATTTTCGGCATTACCTCTACGGCCGAAAATTCAAGGTGATAACCGACTGTAATGCTCTCAAGGCCTCCAAAAACAAAAAGGACTTGCTTCCGCGAATCCATCGGTGGTGGGCGTTTTTGCAAAACTACGAATTCGAGGTGGAGTATAGGAAAGGTGAGCGATTACAGCACGCAGACTTTTTCAGTAGAAACCCTTGCAGCGAGATGTCAGTTAACGTTATGACTCGAGATATGGAATGGCTGCAGATTGAGCAGCACCGCGACGACGTGCTACGCCCAATGATGGAGAGTATAACATCTGGCGATTCCATCGAAGGCTATGTCATGGAAGATGGCATACTTAAGAAAATGCTCACAGATCCTATACTCGGCATACATAAACCAATTGTAGTGCCTAAGTCTTTCCAGTGGAGCTTGATAAACTCCTTCCACGTGACACTGCAGCACCCAGGATGGGAGAAAACTCTGCAGAAGCTACGAGAAACGTACTGGTTTGACAAGATGAACTCGGCTGTTAGACGTTTTGTAGACAATTGTGTTATATGTAGAACCTCGAAAGGACCATCTGGTTCTATACAAGCGCAGCTCCATCCGATCCAGAAACCCACGGCAGCGTTCCAGGTCATTCATATGGACATCACAGGAAAATTGGGTACGAGGAACTCCGAAGGACAAAATGAGTACGTAATTGTTGCTATTGACGCATTCACGAAATACATATTACTGAGCTATTCCAATGACAAGAGCCCGAGCAGTACACTCGCGGCACTCAAGCGTGTCATTCACCTGTTTGGCACCCCGGTACAAGTGGTGGTTGATGGCGGTCGGGAGTTTCTCGGCGAGTTCAAAGTCTACACTGACCGCATAGGGATTGACGTGCATTCAACTGCGCCAGGAACAAGCCGAGCAAACGGACAGGTCGAAAGGGTCATGGGCACATTGAAAAATGCCCTTACCATGATCAAAAACTACAGTACTCAAGACTGGCAGACGGCGCTGGAAGCTTTACAGCTCGCTTTCAACTGCACGCCACATCGAGTGACAGGAGTAGCTCCGCTCACTCTCCTGACCCGCCGACAACATTGCATACCGCCAGAGTTACTAAGGTTGGTGAATATTGAGAACGAATGCATAGATTTTGATCTGCTCGAGCAACACGTACGACAGAAAATGATTGATGCGGCGCAATACAACAAGCAACGCTTCGACAGAGGCAAGGCGAAATTGCGCCCATTTCAACGAGGCGACTACGTACTCGTCAAGAACAATCCTCGTAACCAGACATCCCTCGACCTCAAATACAGTGAGCCATATGAAGTATGCAGAATCCTGGACAACGATCGGTACATCATCAAGCGAGTGACCGGCAGAGGGCGCCCTCGTAAAGTCGCCCACGACCAGTTGCGCCGAGCGCCCCAGCCCGGCGAGCAGGACACCGTGTCGACGGACAGTGTAGAGGACCCCGAGCGACAACCGGCGAGCGTGCCGGCCGACGAGACTGAAACAGATGCCACATCTCGGCCCCAGCCCCTGCCGTCTACCTCGCGAGCTGCCCAGGCCTTGGATGCTTAA
Protein
MSEPCDGVGGVSLSDVTFSKNSPEVGAPSSEVGSPPTSARPSGSVNKNMNTSVDGVPADFFTQMLQMMKHVSDRMTSQSDISKVRINDVFLPSYDPDANVGVREWCQHVTTAMETYNLSDYEVRMKAGSLLKGRARLWVDNWLVSTTTWQELRDVLISTFEPENRYSRDVVRFREHTYDNSKDIAQFLSQAWVLWRRITKDKLSNDDAVEAVIGCIGDERLRIELLNARATSVPELISVASSIKSVKRPHPNASIPHQSVAKRPRFDKTPSFCQICKRSGHDTRDCRYRDKPEGPQPRQQDGKTTPPGVGRPTYQIDQLAGGIYFTTIDMAAGFHQIPISEGSIEKTAFVTPDGLYEYLTMPFGLCNAVSVYQRCINRALAHLTSSPDQVCQVYVDDVLSKCKDFDQGLSHIERILIALQEAGFSINVDKTAFFKRSIEYLGNIIADGQVSPSPRKVEALTKAPIPKTVKQVRQFNGLAGYFRRFIPNFSRVMAPLYELTKNDTTWEWNERHDEARDYIVKHLSTAPTLTLFQEDAPIELYTDASSIGYGAVLVQTFAGRQHPVAYMSQRTTDAESRYHSYELETLAVVRAIKHFRHYLYGRKFKVITDCNALKASKNKKDLLPRIHRWWAFLQNYEFEVEYRKGERLQHADFFSRNPCSEMSVNVMTRDMEWLQIEQHRDDVLRPMMESITSGDSIEGYVMEDGILKKMLTDPILGIHKPIVVPKSFQWSLINSFHVTLQHPGWEKTLQKLRETYWFDKMNSAVRRFVDNCVICRTSKGPSGSIQAQLHPIQKPTAAFQVIHMDITGKLGTRNSEGQNEYVIVAIDAFTKYILLSYSNDKSPSSTLAALKRVIHLFGTPVQVVVDGGREFLGEFKVYTDRIGIDVHSTAPGTSRANGQVERVMGTLKNALTMIKNYSTQDWQTALEALQLAFNCTPHRVTGVAPLTLLTRRQHCIPPELLRLVNIENECIDFDLLEQHVRQKMIDAAQYNKQRFDRGKAKLRPFQRGDYVLVKNNPRNQTSLDLKYSEPYEVCRILDNDRYIIKRVTGRGRPRKVAHDQLRRAPQPGEQDTVSTDSVEDPERQPASVPADETETDATSRPQPLPSTSRAAQALDA

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00665   rve
PF00098   zf-CCHC
PF00078   RVT_1
PF17917   RT_RNaseH
PF00077   RVP
PF16064   DUF4806
Interpro
IPR041577   RT_RNaseH_2        + More
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR018061   Retropepsins       
IPR032071   DUF4806       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
Gene 3D
PDB
4OL8     E-value=1.52571e-51,     Score=517

Ontologies

Topology

Length:
1116
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000970000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00004
outside
1  -  1116
 
 

Population Genetic Test Statistics

Pi
179.817716
Theta
128.676267
Tajima's D
1.174608
CLR
142.997216
CSRT
0.702664866756662
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号