SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12222  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA014150
Annotation
PREDICTED:_isoleucine--tRNA_ligase?_mitochondrial_isoform_X1_[Papilio_xuthus]
Location in the cell
Cytoplasmic   Reliability : 1.708 Nuclear   Reliability : 1.262
 

Sequence

CDS
ATGGATCTCACTAATGGAGACGTGACCTGCGACTCTTATCATCTTTGGGAGAGAGACATAGAAATGGCAACGGAGCTTGGTCTACATTTCTACCGCTTCTCTCTGTCTTGGCCAAGGCTTATGCCTACGGGTTTTAGTAATAAGATCAGCGAAGACGGCCAGAAGTACTACAACAACCTGATTGATGGGCTTTTGGATAAGGGGATTGAACCTCTTGTTACCATTTTTCATTGGGATTTACCCCAGAGTTTGCAGGATCTTGGTGGCTGGATGAATCCGCTGATAGTCGACTGGTTTGAGGACTACGCTAGGGTCGTGTTCTCTCTGTTCGCGGATAGAGTTAAAACCTGGGTCTCTATAAACGAGCCTGTATCGATTTGCGACTATGTTTATAACACTGGCGGAATGGCTCCTCCTATTTTCGAGCCTCACGTGGCCCCTTATGTGTGTACTAAGCATGTTTTGCTGGCTCACGCCAAAGCTTGGAGGATTTATGACGAGGAATTCAGGCCAATGTATAACGGTGAAATCTCGTTGGCCATTCCCCTGATCTGGCACGAAGCATTATCTGCTGAGCATGAAGAACTTGCTGAATTGCTAAGAGAAAATATAGCCGGTCGGTATAGTCACCCAGTCTACTCAAAGGAGGGAGGTTGGCCACCGTCTCTGGAGAAGCATCTGGAAGAGGTCGGCAAACGCAAGGGATTCAACAAATCGGTCCTCCCGCCTTTCACGAAAGAGGAAATAGATTTGATTAGAGGTACATACGACTACTACGGAATGAATTTCTACACGAGTCGTCTGGTGCGGAAGGCGAGGCCCGGCGAATCTATCGGAGCCTGGCCAATGAACGGAGCCCCTGATTTTGACGCAGCCTTCGAGAAAGATCCAAGCTGGGTCGCCGGCTATTCTAGCTGGTTCTATGTAACCCCTGAATATTTCCGACCTCAAATTATGTGGTTGAAAGAAAAATACGGGGACCTGAAGTTCTTGATCACTGAAAACGGTATTTCGACTGGACCAGGATTGGATGACAGAATGAGGGTCGAGTATTATAGGGATCATTTAAAAGAGTTACTTCTAGCCATCCACGAGGACGGCGTTAACGTGGTGGGATTCACAGCGTGGACCCTGATGGACAACTTCGAGTGGAACGATGGTCTCGGATCCAAATTCGGATTATACGAAGTGAACTTCACCTCTCCGCAGCGCACGCGGACGCCACTGACAAAACGACGGAATTATGGGATATTGCTTACAAAATGGGATTGCAAAAGCTGCGTACGCTTAAAAAGTTCAGCAGAACCAAAAACCAAGACCTATTCTCATACGGTATTGACTCCTAAAACAAAATTTCCTGTGCGTTCGACTGCCGTAGTAAAAGATGAAATTCAAAAGAGTGCACAATTTTCGGAATTATATTCATGGCAGAGGGAAAACTTGAAAGGATCCGAATTTGTGTTACATGACGGGCCGCCTTACGCTAATGGTGATTTACATATGGGACATGCTGTGAACAAGATAATTAAAGATATAAATAATCGCAGTCAGATATTACAAGGAAACAAGGTACATTATACGCCGGGTTGGGACTGTCATGGACTTCCGATAGAACTTAAAGCATTACAAAAATCCAAAAAATCATCAACCGGTACTGATCCTATTGCCATACGTACTACAGCAAGGAGCTTTGCCCTAGAAACCGTTGAAAAACAAAAGCAAGCATTTATTAGTTGGGGTATCATGGCCGACTGGGAGAATCACAGTTATTTAACTCTAAAAAATAATTATGTCAAGAATCAATTGCATTTGTTTCATAAAATGTATGAGAAGGGCTATATATATCGTGCATTAAAGCCAGTTTATTGGAGCCCTTCCTCTAGAACAGCTCTAGCGGAAGCGGAACTGGAATACGATCCGCAGTATCGAAGCACAGAAGTGTATGTCACGTTTCCCATAGAGAAGGCACCTGGTTGTGTCAGTGACTATGTGAACGGTATGCCTTTATCTGCAATTATTTGGACGACGACGCCTTGGACCCTGCCCGCCAATCGAGCGATCTGCTACAACCCTCAAATGATGTACAGCATCGTGAAGCTGTCGAACCGACCTGGACAATTCTTAGTGGCCACCAGCCTTATTGGCAGCTTGGAACAAATATTAAGTATTGAAATTAAGAAGATCATAGAGTTTGACGGTGCCCAATTAGAAGGCACATCGTATAGGCACGCTCTGGTGAATGAGGTCTTGCCGTTCCTCCCCGGAGACCACGTCACGGCCGGTAAGGGAACGGGCCTGGTGCACACTGCCCCGGCCCACGGACCAGATGACTTCCTCGTGGCGTTGCGGAATAACATGCGTGTCGAATGCAAAGTGGACGAAGCTGGTCGTTACACCAACCTGGATCCTCAACTGGACGGGCTCCACGTCCTAAGTGAAGGACAGGAGGAAGTGGTAAAGCGTCTTGGGTCTTCTGTTATACACCGCGGGGTGTATACCCACTCGTATCCTCTGGACTGGAGGACGAAGAAACCGATCATCATCAGGGCAAGCGAACAGTGGTTCATTGATACGGCGAAACTTAAGGAACCGGCTTTGAGAGCCTTAGATAGCGTAGATATTCTGCCGCCATCCAGCAGCGCTCAATCTCGTCAGGGCTTCAGGGCTCAGTTGGAGAAGAGGCCGTACTGGTGTATATCCAGACAAAGGGCTTGGGGCGTGCCGATTCCGGCTTTGTATGCTGATGGTGACGTCATCGTTGATATTGGTGTCATAGATAAGCTGTGCGCTCTAATAGACAAGGAAGGAACGGATACATGGTGGACTTGTGACGTGAAGAGTCTCCTACCCGACGATCTACTTAAATCATTAAGTGATCGACAAATCGAAAAAGGAAAGGATATAATGGATATATGGCTGGACTCGGGGCTGTCTTGGAGCACCCTGGACGGCAGAACGGCCGACCTATACTGCGAGGGGGTCGACCAGCTCACCGGCTGGTTCCAAGCCTCGCTGCTGACGTCATTGGCCTTGAATGAGAAACCTCCTTATAAATCCATTTTCGTCCACGGCTTCGTTGTCGACGAGAACAAACGTAAGATGTCGAAATCCATTGGTAACGTGATCGATCCAGACGCAATAATCAACGGCAGCAAAGGAAAAAATCAATCGGCCTACGGAGTTGATACCTTGAGATGGTGGGTAGCTAGTCATTCTACGCAGCACTCACACATAATCATAAGCAGGAATCTTCTAGACGACTGTCGATCCGAAGTGATAAGGATACGTAATATTTTAAAGTACTTATTGGGCGTGATAAGTGATTTGGATAAAACCGATTTTTATCGGGAACCGAATCTGAATTACTTCGATGGGTACATGCGGAAGGAAACTGATGAGTTTTTGAAGCGAATCGAGGATCATTACAATAACTATAGGTACAATAATGTGGCCCAAGCGATACTGAATTTCGTTAGCAGCAAAGTGTCCGCATTGTATTGTCATTGCGTCAAAGATAGATTATACTGTGCGCGCAGGGGTTCGGACGAGCGCCTGTCTGCCCAGTTGGTCGTGCACGCGATTCTGGTCTCTCTGTCCAAAGCCATAGCGCCTATATTACCGCACTTAATCGAGGAAGCGTGGCGTTACCATCCTCTGTACGAGAAACCGTTCTTCATGACCCCCGATATACCGGTGCTGCCCGTTAAACCGATAGAAACGCATTTAATGAACTCGATTTTGGAGATAAAACGCGAAATATGCGTTATAACGAAGAACGAAGATCTGAAAAGATTTTGCGCTAATATCAAATTGAGTAATGATTTGTTCGGCGAATTGAATCCCCTGAATCGATCCGATAGTGACAGTGACAGCGTGCTGTGCGAGATTCTAGAACTGTCATCTGTCAAACTTCACCCGTCAAGTGACGTCAGATTGTTCGAAGTTGAACTGTCACAGAGTAGCCGCGATCAGTGTCTAAGGTGTCGAAAGTATACAGCCACCGTAAATAGTGATAAATGTACGAGATGTGAAAACGTTTTGGATTTGCTTTAG
Protein
MDLTNGDVTCDSYHLWERDIEMATELGLHFYRFSLSWPRLMPTGFSNKISEDGQKYYNNLIDGLLDKGIEPLVTIFHWDLPQSLQDLGGWMNPLIVDWFEDYARVVFSLFADRVKTWVSINEPVSICDYVYNTGGMAPPIFEPHVAPYVCTKHVLLAHAKAWRIYDEEFRPMYNGEISLAIPLIWHEALSAEHEELAELLRENIAGRYSHPVYSKEGGWPPSLEKHLEEVGKRKGFNKSVLPPFTKEEIDLIRGTYDYYGMNFYTSRLVRKARPGESIGAWPMNGAPDFDAAFEKDPSWVAGYSSWFYVTPEYFRPQIMWLKEKYGDLKFLITENGISTGPGLDDRMRVEYYRDHLKELLLAIHEDGVNVVGFTAWTLMDNFEWNDGLGSKFGLYEVNFTSPQRTRTPLTKRRNYGILLTKWDCKSCVRLKSSAEPKTKTYSHTVLTPKTKFPVRSTAVVKDEIQKSAQFSELYSWQRENLKGSEFVLHDGPPYANGDLHMGHAVNKIIKDINNRSQILQGNKVHYTPGWDCHGLPIELKALQKSKKSSTGTDPIAIRTTARSFALETVEKQKQAFISWGIMADWENHSYLTLKNNYVKNQLHLFHKMYEKGYIYRALKPVYWSPSSRTALAEAELEYDPQYRSTEVYVTFPIEKAPGCVSDYVNGMPLSAIIWTTTPWTLPANRAICYNPQMMYSIVKLSNRPGQFLVATSLIGSLEQILSIEIKKIIEFDGAQLEGTSYRHALVNEVLPFLPGDHVTAGKGTGLVHTAPAHGPDDFLVALRNNMRVECKVDEAGRYTNLDPQLDGLHVLSEGQEEVVKRLGSSVIHRGVYTHSYPLDWRTKKPIIIRASEQWFIDTAKLKEPALRALDSVDILPPSSSAQSRQGFRAQLEKRPYWCISRQRAWGVPIPALYADGDVIVDIGVIDKLCALIDKEGTDTWWTCDVKSLLPDDLLKSLSDRQIEKGKDIMDIWLDSGLSWSTLDGRTADLYCEGVDQLTGWFQASLLTSLALNEKPPYKSIFVHGFVVDENKRKMSKSIGNVIDPDAIINGSKGKNQSAYGVDTLRWWVASHSTQHSHIIISRNLLDDCRSEVIRIRNILKYLLGVISDLDKTDFYREPNLNYFDGYMRKETDEFLKRIEDHYNNYRYNNVAQAILNFVSSKVSALYCHCVKDRLYCARRGSDERLSAQLVVHAILVSLSKAIAPILPHLIEEAWRYHPLYEKPFFMTPDIPVLPVKPIETHLMNSILEIKREICVITKNEDLKRFCANIKLSNDLFGELNPLNRSDSDSDSVLCEILELSSVKLHPSSDVRLFEVELSQSSRDQCLRCRKYTATVNSDKCTRCENVLDLL

Summary

Similarity
Belongs to the class-I aminoacyl-tRNA synthetase family.
Pfam
PF00232   Glyco_hydro_1        + More
PF08264   Anticodon_1
PF00133   tRNA-synt_1
Interpro
IPR018120   Glyco_hydro_1_AS        + More
IPR001412   aa-tRNA-synth_I_CS       
IPR009008   Val/Leu/Ile-tRNA-synth_edit       
IPR002300   aa-tRNA-synth_Ia       
IPR033708   Anticodon_Ile_BEm       
IPR014729   Rossmann-like_a/b/a_fold       
IPR013155   M/V/L/I-tRNA-synth_anticd-bd       
IPR017853   Glycoside_hydrolase_SF       
IPR001360   Glyco_hydro_1       
IPR009080   tRNAsynth_Ia_anticodon-bd       
IPR002301   Ile-tRNA-ligase       
IPR023585   Ile-tRNA-ligase_type1       
SUPFAM
SSF47323   SSF47323        + More
SSF51445   SSF51445       
SSF50677   SSF50677       
Gene 3D
PDB
1QU3     E-value=1.55537e-136,     Score=1251

Ontologies

Topology

Length:
1350
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03928
Exp number, first 60 AAs:
0.000790000000000001
Total prob of N-in:
0.00017
outside
1  -  1350
 
 

Population Genetic Test Statistics

Pi
235.498246
Theta
162.933887
Tajima's D
1.215419
CLR
0.466022
CSRT
0.717814109294535
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 FLITENGISTGPGLDDR 100.00 1e-05
28556443 FGLYEVNFTSPQR 100.00 1e-05
28556443 MAIYPALLAER 100.00 1e-05
28556443 SIIDTHSIPK 100.00 2e-04
28556443 TLMDNFEWNDGLGSK 100.00 0.006
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号