SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12219
Annotation
PREDICTED:_uncharacterized_protein_LOC105396011_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.676
 

Sequence

CDS
ATGGATGAACTTTTGAACGTTTTAGAAGATACCGCTGCGCTCTTAAACAAAACTCAAATTAATTTAAAGAAATGTCCAAAAGCTAGATTGACAAGAGGTTATGTAGAAGCAAGAATCAAATGTATCGAAGACTATTGGACTACATTTAAGCAAACGCATCTACAATTGGTAAAAATAACACCGAAAGAACAAAGACAAGAGTTACCATATTTTCAAAATGAAGATTACTTTGTGTTCGAAGATTTGTATCTCGTCTTGTTAGCCGATTTAAAAGATCTTTTGCAATCTTTCACACAAGCAGCCGCGCCGAGTACTTTAACGTCCTCACCAAATAATTCTAAGATTATTGCGGATACCGAAAACCTTGTTCGGTTACCGAGAATCGAATTACCTAAATTCACTGGAAACTATGAAGATTGGCCTACGTTTCAAGACCTATTTACCTCCTTAGTGGATAAGAACCCGGCTTTAAGTGACGTACAAAAGTTATATTATCTTAAGAGTGCAGTCAGCTGCGAGGCAGAAACATTATTAAAACCTATTCAAGTCACGGAAAACAATTATAAAAAAGCATGGAATATTTTGAAGTCAAGGTATGGAAATAAACGATTAATAATTAACTCAGTGTTGAAGAAATTATTTAATCAGAAGAAAATTAATTCTCAGTCTGCAAATCAATTAAAAAATTTATTAGACGTCACGACAGATTGTTTGAATAATTTAGAAAATTTAAACATACCTACGAGCTCCTGGGATCCTATAATTATATTCCTTGTGATACAAAAGTTAGACCCGGAGTCTCACAAAGAATGGGAGCAGACAGCTTATTCAAAATTAGAGGACGAACTACCAACTTGGGAGAATTTTAAGGATTTCCTGCAGTCAAGATACCGTACCTTAGAACTTGTATTGTCCGTGTCAGGGACTTGTAGCAGCCGTGACAAACCTGTAAGAGAACGTTCACATTTACTAACTGCCACAGCCACCACGTCACAGCCAAATGAAAGAACTTGCGTGCTCTGTAAAGAAAAACATACATTATGTCATTGTAAGAATTTTACCAAACTGCAACCTGAAGAAAGAGCTGATTATGTCAAGACCAACAATCTGTGTTTTAACTGTTTGGTGCCTGGGCATTCTGCTTACCAGTGTAAGTTACAAATGTCCTGTCGCTTATGTAGAAGACGGCATCACACTCTTCTCCACCGCCATCAAGACTCGGCACAAACTGAGGAAAAGAATCAACCGAGTGCATCTCACCACGGGGTAGAAGAGAAAGAAGAGGTTATAAATAGCATGGTGGCGTCACATCACAGAACTAAGCAAAGTACAGCACTACTAGCCACAGCCATGGTTTTAACGAGGAACGAGCATAACCAAACCGTTGTTCTTCGTGCGCTAGTAGACCAAGGTTCGCAGGCTTCATTTTTAAGCGAGAAGGCGGCTCAAACGCTCAAACTTACCAGGCAATCAGCGAGAGGAAGTATTATCGGGGTGGGATCTACTAGGACTAATGTTGATCACGTGGTTCAACTTAAGATTGGCTCCCGCTGGAATCCAAGCTTCGAAATCAACATACAAGCATATGTTATGAGTAAACAGTTGACCACAAAGATCCCCTCCAAAGCTGTAACTGTCACACATTGGCCACATCTAGAAGGACTCAACCTGGCAGATCCAGACTACTACCAACCAGGTTCTATAGACTTACTTCTTGGTGTTAAAGAGTATGCACAGATTGTGCAACCAACACTTATTAAGGGCCCTCCAGGTTCTCCATGTGCCCAAGAAACCAACCTGGGGTGGATCCTCTTCGGAGAAATCGATAATAGCCGTGAAAATGAATCATTTCTGGTCCTTCATCATCAAGTCCATATAGATCATATGTTGAAATCCCTCTGGGAAATTGACAATGATAAAAAGAGAATATTAACAAAGGAAGAAAAGCTATGTGAAACAATATATGAAAGCACACATACGAGAAATAGTGAAGGAAGATATCTAGTAAGGCTGCCATTTAATACAAATAATCCAATTTCGATTGAAGGAAATACGAAGGAAATAGCTAGAAAAAGGTTACTTCAACTAGAAAGAAGATTTAAGAAAGAAACTAAACTGAAAGAAGATTATACAAAGGTCATGCAAGAATACATAAAAGCTAACTACATGGAAGAAATACCTAAGAATGAAATAAATGAGAGAAAATCAGTATACTTACCTCATCACGCCGTGGTACACGCAGACAGAGAAACTTCTAAGACACGCGTAGTATTTGATGCTTCAGCGAAGGGCTCTAACTGCGTTTCTCTAAACGATGAATTGCTTGTAGGTCCGCAACTGCAAGAGAACTTAAGGAACATACTTATGAGATCGAGATTACATCGTGTTTGCTATGCAAGTGATATACAAAAGATGTACCTGCAAATATTACTTTATGAAGAAGACGCCGATCGATATCAACGCCTTTTGTGGAGAGAGAATGATACAGACCCGATTAAAGAATATCGTATGCTTCGTGTTACATTTGGTACAGCGGCGGCCCCTCACCTGGCTGTAAGAACGCTTCACCAGGTAGCTGACGATGAGGGTCGAAATCATCCAATGGCTGTTCGAATTATTAAAGAAGATTTTTACATGGACGATCTAATGTCGGGGGAGAGCAGTGCTCCTGAAGCCATAAAGAGAGCACAAGAAGTAGATAATATTCTACAGAAAGGTGGATTTGTATTATCAAAATGGTCATCCAATTCTGCTGAATTTTTGAAATCTATAGAACCAAACAAACGTACATCTCGAGCACAGTTGGATTTTAAATTAGATGGAAATGTACAAGCTCTAGATACTCATACAAAGGCTATGGCTAGAACCGATTGGCTGGATGACGAGATTAACCAATCGCTGTTACACGATTGGCTGACAAGAAGAGAAGACTTTGAACATGTAAAAGAGATAGGTATTCCAAGATGGCTAAACACAGTAAGCACACAGATGGAAAACATCGAGGTTCATGGTTTCAGTGATGCTTGCATGAAAGCCTATGCCGCGGTAGCTTACATTCGTGTGAAGAGGGAAGATGGTTCAGTATTCACCAATCTATTAGCTGCCCGTACTAGAGTGGCACCACTCCGTACCGTGTCTCTACCACGCCTGGAGTTATGTGGGGCGTTGTTATTAACAAGGCTACTTAAGCAAATAGAAAATGCAATGCGTATACGTACTTCTAACATCTATGCATGGACAGACTCATCAATTGTTCTTGCATGGCTATCTGGTGATCCTCATAGATGGAAGACATTCGTGGCGAACAGGGTCGTAGAAATTGTAGAAAATGTAAACACACACCGATGGTTCCATGTAGCTTCGGAAGAGAATCCTGCAGACATCGGGTCGCGGGGCATGCTGCTGGCGGACTTGAAACAGAAAGAGTTGTGGTGGACAGGGCCTAAGTGGTTATGCAAAAAAGAAATAATATACAGTAAGCCTGGAATAACGGAAACAGAATTAGAAATGAAACCAATAAAATTAAATACTTACCACAATACAGAAGAACTAAAACTTATAACCGCTCAGTTTGAAGATTTTGATACGTTACCAGAATTACTAAAAACTATTATTTACTGTAAAAGATTTTTAAGATACAAAAGTAATTTAAGTACGAACAAGGAAATAACTACACAAGAATTAGAAGAGGCGCTTATCACATGCATTAAGTTAGTACAACAAGAATTCAAAGAAGAAATAGATCGGCTAAGAGATAAGAAACAAGTTAGAAGAAAAAGTAAATTACGATCGCTAAACCCATACCTGGATGAGAATCATATCCTCAGGGTGGGCGGTCGCCTTAAACATACTAACTTACCTGATGACCGAAAAAACCCAATTATTATTGGAAATTACAACACCCTAGTACACTTGATCGTTGCTGACGCCCATATCAAGACACTACATGGAGGGATTCAGTTAATGCTATGTTATCTCAGATCAAAATATTGA
Protein
MDELLNVLEDTAALLNKTQINLKKCPKARLTRGYVEARIKCIEDYWTTFKQTHLQLVKITPKEQRQELPYFQNEDYFVFEDLYLVLLADLKDLLQSFTQAAAPSTLTSSPNNSKIIADTENLVRLPRIELPKFTGNYEDWPTFQDLFTSLVDKNPALSDVQKLYYLKSAVSCEAETLLKPIQVTENNYKKAWNILKSRYGNKRLIINSVLKKLFNQKKINSQSANQLKNLLDVTTDCLNNLENLNIPTSSWDPIIIFLVIQKLDPESHKEWEQTAYSKLEDELPTWENFKDFLQSRYRTLELVLSVSGTCSSRDKPVRERSHLLTATATTSQPNERTCVLCKEKHTLCHCKNFTKLQPEERADYVKTNNLCFNCLVPGHSAYQCKLQMSCRLCRRRHHTLLHRHQDSAQTEEKNQPSASHHGVEEKEEVINSMVASHHRTKQSTALLATAMVLTRNEHNQTVVLRALVDQGSQASFLSEKAAQTLKLTRQSARGSIIGVGSTRTNVDHVVQLKIGSRWNPSFEINIQAYVMSKQLTTKIPSKAVTVTHWPHLEGLNLADPDYYQPGSIDLLLGVKEYAQIVQPTLIKGPPGSPCAQETNLGWILFGEIDNSRENESFLVLHHQVHIDHMLKSLWEIDNDKKRILTKEEKLCETIYESTHTRNSEGRYLVRLPFNTNNPISIEGNTKEIARKRLLQLERRFKKETKLKEDYTKVMQEYIKANYMEEIPKNEINERKSVYLPHHAVVHADRETSKTRVVFDASAKGSNCVSLNDELLVGPQLQENLRNILMRSRLHRVCYASDIQKMYLQILLYEEDADRYQRLLWRENDTDPIKEYRMLRVTFGTAAAPHLAVRTLHQVADDEGRNHPMAVRIIKEDFYMDDLMSGESSAPEAIKRAQEVDNILQKGGFVLSKWSSNSAEFLKSIEPNKRTSRAQLDFKLDGNVQALDTHTKAMARTDWLDDEINQSLLHDWLTRREDFEHVKEIGIPRWLNTVSTQMENIEVHGFSDACMKAYAAVAYIRVKREDGSVFTNLLAARTRVAPLRTVSLPRLELCGALLLTRLLKQIENAMRIRTSNIYAWTDSSIVLAWLSGDPHRWKTFVANRVVEIVENVNTHRWFHVASEENPADIGSRGMLLADLKQKELWWTGPKWLCKKEIIYSKPGITETELEMKPIKLNTYHNTEELKLITAQFEDFDTLPELLKTIIYCKRFLRYKSNLSTNKEITTQELEEALITCIKLVQQEFKEEIDRLRDKKQVRRKSKLRSLNPYLDENHILRVGGRLKHTNLPDDRKNPIIIGNYNTLVHLIVADAHIKTLHGGIQLMLCYLRSKY

Summary

EMBL
ODYU01008608    SOQ52337.1    RSAL01000327    RVE42512.1    KQ460036    KPJ18393.1    + More
KQ458473    KPJ05885.1    LNIX01000036    OXA39969.1    GEZM01060254    JAV71154.1    LBMM01008324    KMQ88972.1    GAMC01003146    JAC03410.1    LBMM01009964    KMQ87756.1    LBMM01009551    KMQ88039.1    LBMM01010417    KMQ87475.1    LBMM01008464    KMQ88855.1    LBMM01011492    KMQ86800.1    LBMM01009645    KMQ87967.1    LNIX01000002    OXA60848.1    LBMM01011516    KMQ86784.1    NWSH01000070    PCG79985.1    LBMM01009888    KMQ87813.1    LBMM01009688    KMQ87939.1    LBMM01010405    KMQ87487.1    LNIX01000005    OXA54454.1    ABLF02022040    ABLF02056888    LBMM01007859    KMQ89359.1    ABLF02035780    GFTR01008874    JAW07552.1    KK114194    KFM61875.1    OXA59522.1    AJ487856    CAD32253.1    LBMM01007770    KMQ89434.1    GGMR01018506    MBY31125.1    ABLF02008594    GBBI01004140    JAC14572.1    GBBI01004139    JAC14573.1    GEZM01012999    JAV92824.1    LBMM01008872    KMQ88568.1    LBMM01011051    KMQ87060.1    ABLF02004142    ABLF02066034    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GGMS01010524    MBY79727.1    ABLF02030854    ABLF02067347    LBMM01010986    KMQ87097.1    KQ460500    KPJ14270.1    ABLF02042806    LNIX01000027    OXA41905.1    LNIX01000018    OXA45284.1    ABLF02042264    ABLF02023723    EF426679    ABP48078.1    GGMR01020322    MBY32941.1    ABLF02023842    ABLF02028949    ABLF02058391    GEHC01000869    JAV46776.1    GBGD01000063    JAC88826.1    GBBI01004211    JAC14501.1    GAKP01007887    JAC51065.1    ABLF02018588    ABLF02018590    ABLF02042430    GEHC01000870    JAV46775.1    ABLF02016109    ABLF02016113    GGMR01020500    MBY33119.1    ABLF02041590    LBMM01012238    KMQ86334.1    ABLF02030698    ABLF02030705    ABLF02030709    LBMM01009202    KMQ88311.1    GGMR01013586    MBY26205.1    GEZM01018629    GEZM01018623    JAV90127.1    GGMR01002340    MBY14959.1    ABLF02041505    JXUM01113346    KQ565681    KXJ70776.1    CR954257    CAJ14165.1    ABLF02016099    GGMR01012316    MBY24935.1    GGMS01010815    MBY80018.1    GALX01003264    JAB65202.1    ABLF02009451    GEZM01066272    JAV68024.1    LNIX01000012    OXA47725.1    KQ459312    KPJ01687.1    ABLF02025193    GAMC01006864    JAB99691.1    GGFJ01000337    MBW49478.1    OXA48073.1    KQ458793    KPJ04955.1    GGMR01015704    MBY28323.1    ABLF02041599    KQ460545    KPJ14069.1    ABLF02021176    ABLF02066403    DNYX01000039    HBK82233.1    ODYU01012875    SOQ59395.1    KZ150008    PZC75149.1    GFDF01007667    JAV06417.1    ABLF02041863    NWSH01001945    PCG69607.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF05380   Peptidase_A17
PF18701   DUF5641
PF00008   EGF
PF00078   RVT_1
PF00665   rve
PF00230   MIP
PF12259   Baculo_F
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF07679   I-set
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001878   Znf_CCHC       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR000253   FHA_dom       
IPR000742   EGF-like_dom       
IPR011042   6-blade_b-propeller_TolB-like       
IPR013032   EGF-like_CS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000033   LDLR_classB_rpt       
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR022048   Envelope_fusion-like       
IPR000727   T_SNARE_dom       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR036875   Znf_CCHC_sf       
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR013098   Ig_I-set       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013783   Ig-like_fold       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF81338   SSF81338       
SSF57756   SSF57756       
SSF48726   SSF48726       

Ontologies

Topology

Length:
1330
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05145
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1330
 
 

Population Genetic Test Statistics

Pi
151.30816
Theta
162.588505
Tajima's D
-1.314413
CLR
0
CSRT
0.0884955752212389
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号