SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12217
Annotation
PREDICTED:_uncharacterized_protein_LOC101738890_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.428
 

Sequence

CDS
ATGCTACGTCAAAAAATCATTCAACCCTCTATCTCACCATGGTCAGCACCTATATGGGTAGTACCAAAAAAACAAGACTCCTCCGGTAAACCTAAGTGGCGTATTGTTATCGACTATAGGAAGTTAAATCAAGTAACAATTGGTGATGCCTATCCTATTCCGAACATCACGGATATCCTGGACCAGCTAGGCCACAGTAAATACTTTACCACTCTTGACCTCGCGTCTTCGTTTCATCAAGTCAAGGTGAAAGATACCGAAAAAACAGCATTTAGTGTGCCCTCGGGCCATTACGAGTTCACGCGTATGCCTTTTGGTCTTCGAAATGCTCCTTCCACATTTCAAAGACTCATGAATATAGTACTAAGCGGCCTTCAAGGCACTCATTGCTATACATATTTAGATGATATAGTCGCTTTCAACCACGATCTCTTGTCTCATTGTCAAAACCTCAGAAACATATTTCATAAGCTCCGTGAACACAACCTAAAATTACAACCGGACAAATGTGAGTTCTTTCGTCGAGAAGCACAGTATCTTGGACATATTATTTCAGATAAAGGAGTAATGCCTGACCCCAAGAAGGTTCTCTGTGTTACTAACTTCCCAGTTCCGAAGTCTCCACGTGATATAAAATCATTTCTAGGTTTAGTTGGTTATTATCGTCGCTTCATTGAAAATTTCTCCCATATTACTAAAGCTTTAACTAGCCTTCTAAAAAAGGACGCTACGTTTCAATGGGGTTGTGAACAACAAAAAGCCTTCGACGAACTGAAAAACAAAATAACCTCGGCTCCTATCCTTCAGTACCCTGATTTTACTAAACCCTTCGTACTAACAACAGACGCATCCAATTACGCTGTTTCTGCTATTCTTTCTCAAGGCGAAGTAGGTCAAGATCTCCCAATAGCTTTCGCATCTCGAACCCTGAACAAATCAGAAGGAAATTATTCTACAACCGAAAAAGAATGTTTAGCTATCATTTTCGGCACAAAAGTTTTCAGACCTTATCTGTATGGACACAAGTTTAAAATCGTGACCGATCATAAACCTTTGCAGTGGCTATTTAACTGCAAAGACCCCGGTTCTAAGTTAGTTAGGTGGAGGTTAAAATTAGAAGAATTCGACTACGAGATTGAATACAAAAAGGGGAAGTTAAATTGTAACGCAGATTCCTTATCTCGCAACCTCGTTCATACTCTCGATGAACCAACCGTTTTACAACCACCCCCATACCTTGATGAACAGTCTCGAGTAGATGAGCCCCTTACGTTCGATGACTTGTCTCCGTTACCACCCCCCATAGACTTCAACGCCCCAGGTTCCGTCCCTTCAGAAACCCCTCTTGGACAAGAAATGCCTAGCCACCCTACTCAACCTCCTACAAAAGTCCCTTCTCCATCACTGCCCTCGCAACCGTCACCGTCAACTCCTGAAACCTATGAACAATATCTAAAAGTGTCCCGACAATCGAAAGATCCGTTTAACACAAATATTCAGGAATTTAACGACTCTCTACTTAAAGCTAAATGTAAGCTGATAGCCTACCCTACCTCAATTGACCTTGATGAGTCTGTACCATATTGTTCAGAAATCATAGAAATGTCCACAACTATGCCTGACATACGTGAAGTGGAGAGAGAACTGTACTCATTTTATTCTACCGATTCCAACGACGGTGTCAAGTTCTCTGATGCTATCGACCAAGTACAGTCAGACGAAAAAGCTTTAGCGCATCTTATGCGTGATAATATACATGTGATAAAATCTACAATTTCCACATTTAATAATTCAATGTTAAAATTCAGTGAAAACGAGAAAACGTCTAAATAA
Protein
MLRQKIIQPSISPWSAPIWVVPKKQDSSGKPKWRIVIDYRKLNQVTIGDAYPIPNITDILDQLGHSKYFTTLDLASSFHQVKVKDTEKTAFSVPSGHYEFTRMPFGLRNAPSTFQRLMNIVLSGLQGTHCYTYLDDIVAFNHDLLSHCQNLRNIFHKLREHNLKLQPDKCEFFRREAQYLGHIISDKGVMPDPKKVLCVTNFPVPKSPRDIKSFLGLVGYYRRFIENFSHITKALTSLLKKDATFQWGCEQQKAFDELKNKITSAPILQYPDFTKPFVLTTDASNYAVSAILSQGEVGQDLPIAFASRTLNKSEGNYSTTEKECLAIIFGTKVFRPYLYGHKFKIVTDHKPLQWLFNCKDPGSKLVRWRLKLEEFDYEIEYKKGKLNCNADSLSRNLVHTLDEPTVLQPPPYLDEQSRVDEPLTFDDLSPLPPPIDFNAPGSVPSETPLGQEMPSHPTQPPTKVPSPSLPSQPSPSTPETYEQYLKVSRQSKDPFNTNIQEFNDSLLKAKCKLIAYPTSIDLDESVPYCSEIIEMSTTMPDIREVERELYSFYSTDSNDGVKFSDAIDQVQSDEKALAHLMRDNIHVIKSTISTFNNSMLKFSENEKTSK

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF17917   RT_RNaseH
PF00078   RVT_1
PF01661   Macro
PF17919   RT_RNaseH_2
PF00665   rve
PF12259   Baculo_F
PF02902   Peptidase_C48
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001969   Aspartic_peptidase_AS       
IPR001584   Integrase_cat-core       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041577   RT_RNaseH_2       
IPR002589   Macro_dom       
IPR036875   Znf_CCHC_sf       
IPR022048   Envelope_fusion-like       
IPR003653   Peptidase_C48_C       
IPR038765   Papain-like_cys_pep_sf       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF54001   SSF54001       
Gene 3D
PDB
4OL8     E-value=3.23788e-68,     Score=658

Ontologies

Topology

Length:
610
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00507999999999999
Exp number, first 60 AAs:
0.00035
Total prob of N-in:
0.00107
outside
1  -  610
 
 

Population Genetic Test Statistics

Pi
116.479103
Theta
101.524395
Tajima's D
0
CLR
23.068901
CSRT
0.370681465926704
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号