SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12210
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.064
 

Sequence

CDS
ATGACGGCAAGTCGAGATTGTTTACAGTTAAATAGACCCGTGCATGAAAACAAAGAAATAGTAGTTGCAAATCAAATGACTGTGCCTGTTGTGAGTGTTGGTGAAACACAGATAACCACGATTGTAAATGGTTCTCAGTATGATGTCATTGTAAAGAATGTTTTATACATACCGAAGCTCACGACAAACTTATTATCGGTAAGTCAACTGATAGCAAATGGCAACAAAGTGTCATTTAAGAAGGATGTTTGTTTAATATATAATCCAGTAAATGAGCTTATAGGAATTGCAAACTTAACTAATGGTGTGTACAAACTACAAATACAAAGACCAGAGAGTGCATTATTGGCCATGACAATGTGGCATAGAAGACTAGGACATGTAAACAGTAAATCTTTAGAAATGATGAAAGAAGGTGCTGTGAAAGGGGTTACTTTTGATAAGAAAGCTGATATTCAGATCAAGAACTGTGAAGTGTGCTGTGAGGGCAAACAGGCTCGTTTCCCTTTCCCATCTGCTAATCATAGAAGTGATATACTACTAGAAGTAATACACTCAGATTTATGTGGGCCGATGGAGACCAAATCAATTGGTCAAGCAAAGTACTTTCTTCTGTTCATAGACGATGCCAGCAGAATGACTTATGTCTATTTCTTGAAGGAAAAGAACCAAGTATTCCAGCATTTCAAAGAATTTCGTGTTTTGGTGGAGAATCAAACAGGAAACAAGATCAAAATATTGAGAACAGATAACGGAGGTGAGTTTTGTTCACAAGAGATGGAACACTTCTTAAAACAAACTGGTATCATCCATCAGAAGACTAATCCTCACACTCCACAACAGAATGGACTCTCAGAAAGGTTCAACAGAACTGTAGTTGAACGGGCTAGATGTTTACTGTTTGAATCAGATCTCGACAAAAGTTTTTGGGGTGAAGCAGTGAATACTGCAGTATACCTAATGAATAGAATACCAGCTGTCAGTCTAGGCATGATGACACCATTTGAGAAGTGGACCGGCAAGAAGCCAGATTTGAGCTATGTCAGGATTTTTGGAAGTAAAGTAATGGTGCATGTTCCCAAAGTGCAAAGACAAAAATGGGATAAGAAGGCTGACAAATTAATTCTAGTTGGTTATCCGGATAACGTGAAAGGTTACAGACTATATAACCCCAAAACCAGGAAGATTACTACGAGCAGGGACGTCATTATAATAGAGAAAGAACACTCGGACACAGCTCAGGTAGTAGTAAATAATGAAAAAGTGTTGGAGAAAGTTGAAAATTCAGAGAAAGAGAGAAGCATATCAGAAAATTCAACTATAGACGCTAACGATCCTACATATATTTATGACTCATCGAGCTCCCACGAAGATTCATATCAATCGGAGTATGAAAGTGAAAATGAGTTAACCTTAGAATCCATTTTAGAAGAAAATATTCAAAACTTACAGGAGCTTGGTAAGCGCAAGAGAAAGCCAGTAGAAAGATATGGCTATTCCAATCTCTGCATTGTAGATGAGCTGGAATCCTGTGGTGAAGAACTGAGTTATGAAACAGCAATAAATGGACCAGAGAAGGAACTGTGGGAACAGGCGATGGCAGAAGAACTGAAGGCATTTGAAGAAAATCAAGCATGGGAATTTGTTGACAGAAAAGAAGCTGATAGGGTGGTGCAATGGCTAGACTGGTAG
Protein
MTASRDCLQLNRPVHENKEIVVANQMTVPVVSVGETQITTIVNGSQYDVIVKNVLYIPKLTTNLLSVSQLIANGNKVSFKKDVCLIYNPVNELIGIANLTNGVYKLQIQRPESALLAMTMWHRRLGHVNSKSLEMMKEGAVKGVTFDKKADIQIKNCEVCCEGKQARFPFPSANHRSDILLEVIHSDLCGPMETKSIGQAKYFLLFIDDASRMTYVYFLKEKNQVFQHFKEFRVLVENQTGNKIKILRTDNGGEFCSQEMEHFLKQTGIIHQKTNPHTPQQNGLSERFNRTVVERARCLLFESDLDKSFWGEAVNTAVYLMNRIPAVSLGMMTPFEKWTGKKPDLSYVRIFGSKVMVHVPKVQRQKWDKKADKLILVGYPDNVKGYRLYNPKTRKITTSRDVIIIEKEHSDTAQVVVNNEKVLEKVENSEKERSISENSTIDANDPTYIYDSSSSHEDSYQSEYESENELTLESILEENIQNLQELGKRKRKPVERYGYSNLCIVDELESCGEELSYETAINGPEKELWEQAMAEELKAFEENQAWEFVDRKEADRVVQWLDW

Summary

Similarity
Belongs to the protein kinase superfamily. Ser/Thr protein kinase family.
EMBL
AGBW02009826    OWR49812.1    GEZM01011855    JAV93396.1    GALX01001351    JAB67115.1    + More
GEZM01011856    JAV93393.1    GEZM01011859    JAV93384.1    GEZM01011857    JAV93390.1    KQ460297    KPJ16236.1    DNYX01000353    HBK84078.1    GEHC01000991    JAV46654.1    GEHC01000990    JAV46655.1    NWSH01002292    PCG68657.1    PCG68658.1    LBMM01004924    KMQ91985.1    NWSH01000816    PCG74073.1    GBHO01026200    JAG17404.1    GEHC01000989    JAV46656.1    GEHC01000988    JAV46657.1    GEHC01000987    JAV46658.1    GBHO01003630    JAG39974.1    GBHO01035390    JAG08214.1    GEZM01045163    GEZM01045162    JAV77888.1    GBXI01011094    JAD03198.1    LBMM01008124    KMQ89126.1    JYDH01000330    KRY26801.1    JYDT01000069    KRY86576.1    KL367475    KFD72989.1    JYDJ01000808    KRX33413.1    KRY26802.1    GAKP01015352    JAC43600.1    JYDR01000001    KRY80095.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    GFTR01008662    JAW07764.1    JYDJ01000136    KRX42725.1    KL367628    KFD61291.1    KQ459875    KPJ19636.1    GANO01000510    JAB59361.1    GDHC01011760    JAQ06869.1    JYDU01000001    KRY01876.1    LVZM01021469    OUC41357.1    KL367553    KFD64618.1    JYDQ01000110    KRY14711.1    GBHO01011746    GBHO01011744    GBHO01011742    JAG31858.1    JAG31860.1    JAG31862.1    NEVH01019375    PNF22597.1    NEVH01006980    PNF36330.1    NEVH01006721    PNF37230.1    NEVH01002725    PNF41351.1    LBMM01012464    KMQ86211.1    JYDI01000006    KRY60323.1    LSMT01000790    PFX14364.1    CM007903    OTF97009.1    CM007899    OTG12557.1    CM007904    OTF93985.1    GDHC01012180    JAQ06449.1    CM007900    OTG08534.1    JYDL01000297    KRX12674.1    GBHO01036544    JAG07060.1    GFTR01008771    JAW07655.1    GBHO01019781    JAG23823.1    CM007901    OTG04806.1    LBMM01008884    KMQ88558.1    CM001883    EOY11267.1    JYDP01000032    KRZ13440.1    NCKU01018139    RWR98872.1    CM001887    EOY32548.1    LBMM01010726    KMQ87289.1    LBMM01009686    KMQ87943.1    CM003608    KYP66219.1    KQ460882    KPJ11482.1    JYDM01000091    KRZ88014.1    GBHO01016859    JAG26745.1    GBHO01043059    JAG00545.1   
Pfam
PF13976   gag_pre-integrs        + More
PF00098   zf-CCHC
PF00665   rve
PF07727   RVT_2
PF13961   DUF4219
PF08263   LRRNT_2
PF00069   Pkinase
PF00560   LRR_1
PF13855   LRR_8
PF14244   Retrotran_gag_3
Interpro
IPR025724   GAG-pre-integrase_dom        + More
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR025314   DUF4219       
IPR017441   Protein_kinase_ATP_BS       
IPR011009   Kinase-like_dom_sf       
IPR032675   LRR_dom_sf       
IPR008271   Ser/Thr_kinase_AS       
IPR001611   Leu-rich_rpt       
IPR013210   LRR_N_plant-typ       
IPR000719   Prot_kinase_dom       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR029472   Copia-like_N       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF56112   SSF56112       
Gene 3D
PDB
1C1A     E-value=0.000545107,     Score=104

Ontologies

Topology

Length:
563
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11169
Exp number, first 60 AAs:
0.0704
Total prob of N-in:
0.00642
outside
1  -  563
 
 

Population Genetic Test Statistics

Pi
224.744563
Theta
129.430155
Tajima's D
2.549864
CLR
0
CSRT
0.949952502374881
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号