SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12159
Pre Gene Modal
BGIBMGA009853
Annotation
PREDICTED:_uncharacterized_protein_LOC105843021_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.787
 

Sequence

CDS
ATGAGAACTAGCCACTCACAGTATTTAACAATGGTGGAATTTATGGAAGCAAATGGAGATTTATCAAAACCATCAGGCGGTCCACGAGGTCGCAATTTTATACAGATGAAGTGGAAAGAGTTAACGGCATTACTAAATAGCGATTCTTCAGGAGATCCTAAGAGTGAGGACAAATGGCGTAAGGTGTGGAGTGATTATAAGAATAATTGCAAGAAAAAGTGTGCTAAAATTAATAGAGCTGCTAGTGGCACTGGTGGCGGACCAGCGCTCCATTTATTATTGACTGACCAAGAACAAAGGGTCATGCAGATAATTGGAGTGCAGGCAGCTACTGGCATGGAGATAAAAGAAGCTGGGTTTCCACAAGAAGAAATTTCAACTGAGATGCCCAATACTCAAATTATTTTAAAGGAACCGGAAATAGATTGGAATGCTCCTAGCACAAGCAGCCAACCAACAGTGGCTCCACCACCACCAACTGAGGCTCCCCCTCCAGTCATTAACGAGGAAGAGGAGTGGAACCCTCCGCCGCAGAAAAAAAGAAAAAACAATTTAACAAAAATATTTTTAGATATAGACAGAAAGGCAAGGGAGTATGCTTCAGAGCGTGATAGGTATATGAGGAATTAG
Protein
MRTSHSQYLTMVEFMEANGDLSKPSGGPRGRNFIQMKWKELTALLNSDSSGDPKSEDKWRKVWSDYKNNCKKKCAKINRAASGTGGGPALHLLLTDQEQRVMQIIGVQAATGMEIKEAGFPQEEISTEMPNTQIILKEPEIDWNAPSTSSQPTVAPPPPTEAPPPVINEEEEWNPPPQKKRKNNLTKIFLDIDRKAREYASERDRYMRN

Summary

Pfam
PF13873   Myb_DNA-bind_5        + More
PF00096   zf-C2H2
Interpro
IPR028002   Myb_DNA-bind_5        + More
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR026753   NAIF1       
SUPFAM
SSF57667   SSF57667       

Ontologies

Topology

Length:
209
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0461
Exp number, first 60 AAs:
0
Total prob of N-in:
0.37784
outside
1  -  209
 
 

Population Genetic Test Statistics

Pi
235.257516
Theta
141.783482
Tajima's D
2.054252
CLR
0
CSRT
0.890205489725514
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号