SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12155
Pre Gene Modal
BGIBMGA004257
Annotation
hypothetical_protein_ALC57_15604_[Trachymyrmex_cornetzi]
Location in the cell
Nuclear   Reliability : 3.459
 

Sequence

CDS
ATGGTTGCTGCGTCAGATGCAAACTCAGACTTGTCTAAAACAGTTGTCAAACTTGGAGGATTTCATATGCTCATGTCTTTTCTTGGATGCATAGGACATGTAATGGACGGTAGTGGTCTCAAGGAAGCTTTAAGTAAAATATATGCTACAAATTCGGTCGACAAAATGTTGAATGGTCACGCTTATGCAAGAAGTATCAGAGGCCATATATTATTACGACTTGCATTATCAATAAAGATTTTTGAAGAGATGAAAATTGAAAATTGTGTGTTAGATGAGTTAATTGAACAGATAACTAGTCGCGATGTTTCCTACGAAGATGTTGAAGGATGTACGAGCAGCTCCAACTCGTTAATTGATCAATTTCAGGATAAACTAAAAGAATTAAAAGCTCGAGGTCCCACGGCACAGTTATGGGTGCAATATTTTGAAATGGTATCAATAGCCCTAGATTTCATTCGCGCTGAAAGGCTGGGACTTTTTCAAGAACATTTGGATGCAGTGCGAAAAATGCTGCCCTATTTTCATGCTGGTGGTCATTTCCTATATGCGAAGTCAGCTCATTTGTATCTTCAAGATATGTTAAAACTTGAGGAGACAATGGATCAACAGGTTTTTGAGAACTTTAAAAACGGATTCTTTACTGTAAAACGAACAGAAAAATTCAATTCTGGTACATGGACAGACATGGTAATCGAGCAAAGTCTGATGAAATCTATGAAGACAGAAGGAGGAGTATCTCGAGGCCGAAGTACACAAGAAAGTGTTCTATGTAAGTGGGTATATGCTATGTATGCCACGAATACAATTTGTGAAGAAATTGAACGGTTTTGTAACATTTCTTTCGATTCTGTGGACCAACATGTTGATGCTAGAGATTCACGAATAAAAAGGGATGATACTGATGTAAATGAACTGGTTGGTTGGTTTACGCTTCATAATCCCTTTCCAAATGCGAATCAGTTGGTATCCTTAGCTTCAGGAATCGTTGGAAATGACCAAATTAATTGTTACCGAGCCCATGAAATCGGATTGCAATCTATGGTAAAGATAACTGGTTTGAACTTCAACGAAATAAAGTTAAAACGCGTCGATAAGGTTTTACCGCTTTCAGCCATTAACAAATCTGTCAAAATTAATGATTGTAAAGTTTCTATAGATCCAATGTTACTTTTCCAGAGAATAACTGTAAGCAAAAAATTTGAAAGTAATTTACAAGAATATCTTCAGTATGAACTAAGTCCGTATCTGACATCTTTATTTGATAGTAATGGCATGAGAAAAACCACGAAAGCAACATTATATGACAATATGATGCCTGTCGTTATCGATCTTGATGAAAATAATGTAACATACATCATCGATGGTGGATTTCTTCTGCATCGCGTCGTATGGAGCAAAGACGATACTTTCTCTATTATTTTAAATAAGTACATTAAATATTTACAAACACATTATGGCTCAGCAATTGTTGTTGTATTTGACGGATATTCGGACTATAGTAAAAATATTAAAGCACTGGAACAACAAAGAAGAACTGCTGCACTTTCAAAATCATATGAAGTTTGTTTTGACGAAACAATGGTTGTGCCAATCAGTCAAGAATTTTTTTTATCAAATCGGTCTAATAAAAAAAAATTTATCGACATGCTTGTTGAAAAATTTAAAACTGTTAATATCACAACAAAACAAGCCAGAGATGATGCTGATGTTCTCATCATTGACACAGCTATTGCCTTATCAGAACATCAAAAGACTGCTGTCATCATAGGAGAAGATATCGATTTGCTCGTTATTTTAATTGGACGTACTCAGTCACATCATCAGGAAATTTTTTTGAAAAAAGTTGGCAAAGGCAATGTCAAAACACAAATATATTCTACTAAAAGTTTTGACCAATATCCTCGTACTAAAAAGCACATTTTATTTTTACACGCATTCAGTGGCTGTGACACGACTTCTGCGCTATTTAAAAAAGGAAAAAAAACTGTTACTAGAGCATTGGAAAAAAATCCTCATTTAGATAAACTGGTGGAAGTATTTCAACAAGAAAACTGCCCAAAACAAACATTATTAGAAAATGGAGTGCGCATCTTGTTGGCATTATATAATGCTCCAAAATCTGAGGACAACATTGATCATTTCCGCTACACGCAATTCATCAAATTTACAAAACTAAATAAACCTGTACAACTGTCAACACTTCCACCAACAAGTGTAGCAGCTCATCAACACATAAAACGTGTCTACTACCAGATTCAAACGTGGTTAGGGAAGGACTTAGAACCTCAAGAATGGGGCTGGATGCTTGAAAATGAAATCCTGGAGCCCATACGAACGTTATTACCTCCAGCACCAGCCGAACTACTAAACGTAATATTTTGCAATTGCAAAAATGGTTGTGGTTCCCGCTGTGGATGCAGAAAATCAGGGCTACAATGTTCTTTAGCTTGCGGCCAGTGCAACGGACAAGCTTGCCTCAACGCTTCACTGTATCCAAGTAATCCCGATGAAGAAAATACATATGATCCCGATATTCTCGAAGGTTTGGAGATGAACATGACAGATAATGAGGATGATGACAATGAATCGAACATTTTTGAGCGACAAGAAGAAGAAGACAACGAAGAAGAAGAAGATAATTAG
Protein
MVAASDANSDLSKTVVKLGGFHMLMSFLGCIGHVMDGSGLKEALSKIYATNSVDKMLNGHAYARSIRGHILLRLALSIKIFEEMKIENCVLDELIEQITSRDVSYEDVEGCTSSSNSLIDQFQDKLKELKARGPTAQLWVQYFEMVSIALDFIRAERLGLFQEHLDAVRKMLPYFHAGGHFLYAKSAHLYLQDMLKLEETMDQQVFENFKNGFFTVKRTEKFNSGTWTDMVIEQSLMKSMKTEGGVSRGRSTQESVLCKWVYAMYATNTICEEIERFCNISFDSVDQHVDARDSRIKRDDTDVNELVGWFTLHNPFPNANQLVSLASGIVGNDQINCYRAHEIGLQSMVKITGLNFNEIKLKRVDKVLPLSAINKSVKINDCKVSIDPMLLFQRITVSKKFESNLQEYLQYELSPYLTSLFDSNGMRKTTKATLYDNMMPVVIDLDENNVTYIIDGGFLLHRVVWSKDDTFSIILNKYIKYLQTHYGSAIVVVFDGYSDYSKNIKALEQQRRTAALSKSYEVCFDETMVVPISQEFFLSNRSNKKKFIDMLVEKFKTVNITTKQARDDADVLIIDTAIALSEHQKTAVIIGEDIDLLVILIGRTQSHHQEIFLKKVGKGNVKTQIYSTKSFDQYPRTKKHILFLHAFSGCDTTSALFKKGKKTVTRALEKNPHLDKLVEVFQQENCPKQTLLENGVRILLALYNAPKSEDNIDHFRYTQFIKFTKLNKPVQLSTLPPTSVAAHQHIKRVYYQIQTWLGKDLEPQEWGWMLENEILEPIRTLLPPAPAELLNVIFCNCKNGCGSRCGCRKSGLQCSLACGQCNGQACLNASLYPSNPDEENTYDPDILEGLEMNMTDNEDDDNESNIFERQEEEDNEEEEDN

Summary

Pfam
PF03564   DUF1759        + More
PF05585   DUF1758
Interpro
IPR029060   PIN-like_dom_sf        + More
IPR005312   DUF1759       
IPR008737   Peptidase_asp_put       
IPR011011   Znf_FYVE_PHD       
SUPFAM
SSF88723   SSF88723        + More
SSF57903   SSF57903       

Ontologies

Topology

Length:
881
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.99878000000001
Exp number, first 60 AAs:
3.9542
Total prob of N-in:
0.18466
outside
1  -  881
 
 

Population Genetic Test Statistics

Pi
22.315279
Theta
36.296853
Tajima's D
-0.478842
CLR
5490.4319
CSRT
0.245387730613469
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号