SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12150
Pre Gene Modal
BGIBMGA004258
Annotation
polyprotein_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.011 Nuclear   Reliability : 1.44
 

Sequence

CDS
ATGTCTTTAGAAGACAACGAAAGCTTCACAGTTTCACGGGACAACGAGAACTGGTACATAGGTAATGGCGCAACAAGCCACGTCACCAACAGAGCTGACCTTTTCCAAACCTACGAACATTTCAATGAGAACTACACTGTTACAACGGCCGCTGGTAATGAAGTCCGTGCCAAAGGCAAAGGAACAGTACAGCTCAGAGATGTTAACGGGAAACAAATCGACATCAGCCTGCAAGACGTCTGGTACGTTCCGGCCATAAGCAAGAACCTCTTCTCCGTACTCGCACTTCACGATCGAGTCCCGAATAGCACCTTTTCATCCAGGACAACTGCATGCAACGTCATTGTCAACGGGAAAGTATGCTTGATAGGGAAGAGACAAAAACAAGGTGGCTTATATCGACTGGAAGTAAAACCCGTATTGCCAGAAAAACCACCCGAAGTCTTTGCAACTACAGCAACGATGCAACTGTACCACGAGAGACTCGCTCACCAAAATAAAAGACACGTAAGAGCGACGATCCAACGGGAACTAGGTCTAATCCTGCCGATGGATAAAGATACCTGTGAAGGCTGCATCTTTGGAAAGGCGCATGGACTTAAATTCGGTACAAGAACCCGAGCTACCGCGCCCGGAGAAATCGTACACACCGACGTTTGCGGCCCGTTTCAACCTAGCTTCTCAAACTATAAGTACTACGTTCTGTTTAAAGACGACTTTACTGGCTATCGTATGGTGTACTTCATACGCAAGAAGTCCGAGGTCAAAGACAAGTTAGTTTTGATGATCGCTCAAACTAAAACAGTCGGACACACCATAAAATGCCTTCTAAGTGACAACGGCGGTGAATTTGACAACGCGTCCATAAAAAGTGTTTTAGACACACATGGAATAGCACAGCGACTCGTCACCCCGTATACACCTGAACAAAACGGAGTAAGCGTAACGGAGATAGCAAGATCAATGATGTACGCTCATGAGCCATTACCGCAAGTGCTATGGGCAGAGCTCATTAATACCGCCGCATACATACTGAACAGAACAGGTCCCACAAGTTCAGATAAATCTCCGCATGAACTTTGGTATGGAAAGAAACCTATTATTAAACATCTCCGAATAATAGGCTCAATCGCATACGTCCATATTCCAAAGCAGAAGCGTAGAAAATTCGACAAAAAGGCGATAAAAGGTCGACTTATCGGGTACGACGAAGATTGCTACCGTATCTGGATCACAGACGGAAAACACTCGACGCTCGTCCGCTCTCGTGACGTAATCTTCGATGAGAAACCTCTTCCTATCTGTAATAGTGAAATTCCTAAAACAGAAGTTGAGACAAGAGAATACCCGATTACCATAACGCCAAATACGAACTTAGAAAGAGAAGTTACAATTCCAGAGCAAACACACGTTCACGAGAGAGATACAACTACCGAAACAATCTCCAACGAGCATGATCATGTTCTCGAGGGAGAAGAGTCGGATCAAGTCCTCTACGAAAACCATGACCATGAAGACGAAATGACAGTTCCAGAAGAATTTTATGACGCTGAACCACCGCCAACCGACTATAATCTTAGAGATCGCTCACTGATTCGACGTCCTGAGAGACTAAGAGATTACGTCTGTATCACTGAAACATTCCCAAATAATTTCGCAGACGCTATGAAAAGGGACGATCGCGAAGAATGGCAAAGAGCAATGGATAGCGAATTGAAATCCTTCGAAGACCTGAACGTTTGGACGCCGTGTGCATTGCCAAAAGGACGAAAAGCACTTCCCTGCAAATGGTTTTTACGGATCAAAGGAAATCCAGATGGCACGATCGACAAATACAAAGCTCGATTTGTCGTAAAAGGGTACAGACAAAGGAAAGGAGTAGACTATGACCAGACCTTCAGTCCTGTGGCACGCCTGACTACTGTACGAGCACTACTCAGTGTTAGTGCGCATGAAAACTTACATCTGGTCCAATTCGACGTCTGCACAGCCTTTCTGAACGGAAAGCTCGAGGAAGAAATATACGTTCAATCGCCAGAAGGGTGCAACCTCACGGAAGGAACGTCTACCGTTTTCAAGCTTAACCGTAGCCTGTACGGACTTAAACAAGCACCAAGTGGGTATGAATGA
Protein
MSLEDNESFTVSRDNENWYIGNGATSHVTNRADLFQTYEHFNENYTVTTAAGNEVRAKGKGTVQLRDVNGKQIDISLQDVWYVPAISKNLFSVLALHDRVPNSTFSSRTTACNVIVNGKVCLIGKRQKQGGLYRLEVKPVLPEKPPEVFATTATMQLYHERLAHQNKRHVRATIQRELGLILPMDKDTCEGCIFGKAHGLKFGTRTRATAPGEIVHTDVCGPFQPSFSNYKYYVLFKDDFTGYRMVYFIRKKSEVKDKLVLMIAQTKTVGHTIKCLLSDNGGEFDNASIKSVLDTHGIAQRLVTPYTPEQNGVSVTEIARSMMYAHEPLPQVLWAELINTAAYILNRTGPTSSDKSPHELWYGKKPIIKHLRIIGSIAYVHIPKQKRRKFDKKAIKGRLIGYDEDCYRIWITDGKHSTLVRSRDVIFDEKPLPICNSEIPKTEVETREYPITITPNTNLEREVTIPEQTHVHERDTTTETISNEHDHVLEGEESDQVLYENHDHEDEMTVPEEFYDAEPPPTDYNLRDRSLIRRPERLRDYVCITETFPNNFADAMKRDDREEWQRAMDSELKSFEDLNVWTPCALPKGRKALPCKWFLRIKGNPDGTIDKYKARFVVKGYRQRKGVDYDQTFSPVARLTTVRALLSVSAHENLHLVQFDVCTAFLNGKLEEEIYVQSPEGCNLTEGTSTVFKLNRSLYGLKQAPSGYE

Summary

EMBL
AB378753    BAG68376.1    GEZM01099107    JAV53485.1    GEZM01078128    GEZM01078127    + More
JAV63002.1    LVZM01009926    OUC45303.1    KL367622    KFD61455.1    JYDM01000206    KRZ83588.1    JYDO01000312    KRZ65659.1    JYDH01000102    KRY32233.1    KRY32232.1    JYDV01000020    KRZ41499.1    GBHO01013359    JAG30245.1    LVZM01021469    OUC41373.1    JYDV01000213    KRZ24707.1    JYDR01000237    KRY65040.1    KL367520    KFD66793.1    JYDK01000067    KRX78390.1    KL367684    KFD60227.1    KFD66858.1    ABLF02020242    ABLF02020246    ABLF02042026    KL367545    KFD65036.1    GEZM01063217    JAV69187.1    KQ971352    KYB26731.1    LBMM01012672    KMQ86059.1    GEZM01078105    JAV63008.1    GEZM01096605    JAV54776.1    GEZM01096656    JAV54693.1    ABLF02066512    GBHO01016859    JAG26745.1    GBHO01043059    JAG00545.1    GDIP01034138    JAM69577.1    LBMM01010801    KMQ87218.1    LBMM01012536    KMQ86167.1    GDIP01162319    JAJ61083.1    GDIP01198316    JAJ25086.1    GDIP01156971    JAJ66431.1    GGFL01005562    MBW69740.1    GGFM01000952    MBW21703.1    AAZX01004352    LBMM01003976    KMQ92933.1    GGFL01004951    MBW69129.1    GGFM01000953    MBW21704.1    LBMM01004825    KMQ92052.1    JYDL01000266    KRX12804.1    LBMM01010133    KMQ87653.1    GDIP01239569    JAI83832.1    NEVH01009420    PNF33053.1    JXUM01085595    KQ563513    KXJ73717.1    ASHM01002084    PNY07765.1    LBMM01005619    KMQ91367.1    GEHC01000959    JAV46686.1    LBMM01008998    KMQ88473.1    KQ483989    KYP38573.1    GEZM01007166    GEZM01007165    JAV95327.1    JYDM01000301    KRZ82363.1    GDIP01019956    JAM83759.1    ASHM01014005    PNX95963.1    GDIP01039936    JAM63779.1    GEHC01000928    JAV46717.1    KQ459875    KPJ19636.1    GEHC01000868    JAV46777.1    NWSH01000816    PCG74073.1    GEHC01000867    JAV46778.1    JXUM01136904    KQ568499    KXJ68982.1    DF973673    GAU37486.1    ASHM01014140    PNX96091.1    JYDW01000105    KRZ55879.1    GEZM01063091    JAV69316.1    GEVI01023957    JAU08363.1    CM007895    OTG22666.1    JXUM01155348    KQ572178    KXJ68066.1    NEVH01019375    PNF22597.1    GEHC01000923    JAV46722.1    DS567278    CM007900    OTG06758.1    ABLF02042030    GBHO01012744    JAG30860.1    GDIP01209409    JAJ13993.1    GAMC01008189    JAB98366.1    NEVH01006980    PNF36330.1    NEVH01002725    PNF41351.1    GDUN01000696    JAN95223.1    GDUN01000697    JAN95222.1    NEVH01006721    PNF37230.1    FJ238509    ACI62137.1    D83003    BAA11674.1    ABLF02041793    JXUM01099923    KQ564528    KXJ72133.1    LXQA010000987    MCH80374.1    AC133339    DP000009    AAP46257.1    ABF99717.1    GEHC01000966    JAV46679.1   
Pfam
PF13976   gag_pre-integrs        + More
PF07727   RVT_2
PF00665   rve
PF00098   zf-CCHC
PF13961   DUF4219
Interpro
IPR025724   GAG-pre-integrase_dom        + More
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR012337   RNaseH-like_sf       
IPR013103   RVT_2       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR025314   DUF4219       
IPR011009   Kinase-like_dom_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF56112   SSF56112       
Gene 3D
PDB
3S3O     E-value=0.00101518,     Score=103

Ontologies

Topology

Length:
709
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0013
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00012
outside
1  -  709
 
 

Population Genetic Test Statistics

Pi
0.609524
Theta
3.289592
Tajima's D
-2.150013
CLR
3031.601711
CSRT
0.00499975001249937
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号