SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12149
Annotation
PREDICTED:_uncharacterized_protein_LOC106708887_[Papilio_machaon]
Location in the cell
PlasmaMembrane   Reliability : 1.221
 

Sequence

CDS
ATGACGATTCCGAAGCTCGAGTTGTCTGGTGCCGCTCTACTGACTAGGTTGTTAAACCATACAGCTACTAGTTTACGGTCGGTTATTGATTTAGAAAACACTGTGTATGCTTGGACAGACAGCCAGATAGTGTTGTGCTGGTTGAAGGCTTCGGTTCATACACTTGAAGTTTTCGTGGCCAACCGTGTCTCCCAGATTCAAGGATCTGAGGTCCCTCTAACATGGAGACACGTGCCTGGTGAGCTCAATCCGGCGGACTGCGCTTCTCGGGGATGCTTAGCATCGGAAATAGTTGATCATCAGTTATGGTGGGGTCCCCAGTGGCTCACAATGAAGGCTTCTCAGTGGCCACCCTCTCGCATAGGAGTTCCTCCAGGTCTCGTGGCTGCACCGGCGCAGTTCGAGGATCGAGGAGTGATTCAGGGGTTGGATTTGGATCTGCTCATCAACCGTTATAGCTCCTTGGACAAGCTGGTTAAGGTTACCGCCTGGATTTTGAGGTTTATTCGGAATTGTCGTTTGTCGGTGTCTCAACGCAATATGACACCTGTTGTGTGTCCCATCGAGCGGAAGAAGGCACTGCTGAAATTAATTGAAGTTGTGCAAGCCACCAGCTTTCATTCAGAATTGAAGGCGCTAAGGACTGAGCGCCCTAAGCTTCGTGGAGCTATCGCTCGTCTTAGCCCCTTTGTAGACGGCCAGGGGTTGATTCGAGTGGGAGGTAGATTAAGTAACTCCAATTTACCTTATTCGGCGCGCCATCCTCTTTTACTTCCCAAGAAGAGCCAGTTAGTTGACCTGTTGGTGATGGATCGCCACATCGCAAATTCGCATTCCGGTTGCAATGCGCTGCTGGCATCCCTCCAGAGGGAATTTTGGATTCTGTCAGGGCGTCGTACGGTTCGGAGCGTCCTTTTCCGGTGTTTACCCTGTTATCGGCTTAAGGCGTCTACGATGCAGCCTCAGATGGGAGATCTGCCTCCAGACAGAGTGAAGAAGATGAGGCCGTTTTCTGGAGTTGGTACGGACTTCGCTGGGCCCTTCATGATCAAGGCTTCACGTTTGCGGAATGTTAGGTTAATTAAGGCTTATCTGTGCGTCTTTGTCTGCCTTTCAACCAAAGCTGTACATCTTGAAGTTGTTGCCGACCTTACAACTGAAGCCTTTATTGCGAGCTTGGATAGATTTGTGTCCCGTCGAGGCTTACCCGAATTGATACGCTCCGATAACGGAACGAATTTTGTAGGTGCGGACCGTTACTTGCGGGATGTAGTAAATTTCTTGAACAATAACCAGGTGGATATTGAAACGGCCCTCTCTCGTCGCGGTATTCGGTGGACCTTCAGTCCTCCAGGATGCCCCCACTGGGGTGGAATTTTCGAGGCAGTAGTAAAATCGGCTAAGACTCACTTGATGCGCGTGATAGGGCAAACCTCGCTCACCTTTGAGGAGTTAACCACGGTATTTTGTAAAATTGAAGCGGTACTTAATTCGCGGCCGTTGTGCCCGCTCAGTTCAGACCCGAATGACTTGGAATCGTTAACTCCAGGCCATTTCTTGATAGGACAGCCACTCAATGCGTTGCCGGAGTATCCCCTCTCGGATATCAAGCCTGGACGGTTGAGGCGATACCAGATGTTGCAGCAGATGTCCCAAGATTTTTGGAAACGTTGGTCCCTTGAGTATTTACATCTGCTCCAGCAGCGCTTTAAGTGGACGGATAGAACCAGTCCCCCTCACGTCGGTGACCTTGTGTTGGTTAAGGATGCTAACCTGCCGCCACTGCGTTGGCGTAGGGGGCGCATTGTTAATCTGTTTCCCGGTAAGGATGGGACCCCACGGTCTGCAGAGGTTCTGGTCGGGGACTCGGTTCTCAAACGAGCGGTCACAACGTTGTCCCGGCTGCCAGTTGATTAG
Protein
MTIPKLELSGAALLTRLLNHTATSLRSVIDLENTVYAWTDSQIVLCWLKASVHTLEVFVANRVSQIQGSEVPLTWRHVPGELNPADCASRGCLASEIVDHQLWWGPQWLTMKASQWPPSRIGVPPGLVAAPAQFEDRGVIQGLDLDLLINRYSSLDKLVKVTAWILRFIRNCRLSVSQRNMTPVVCPIERKKALLKLIEVVQATSFHSELKALRTERPKLRGAIARLSPFVDGQGLIRVGGRLSNSNLPYSARHPLLLPKKSQLVDLLVMDRHIANSHSGCNALLASLQREFWILSGRRTVRSVLFRCLPCYRLKASTMQPQMGDLPPDRVKKMRPFSGVGTDFAGPFMIKASRLRNVRLIKAYLCVFVCLSTKAVHLEVVADLTTEAFIASLDRFVSRRGLPELIRSDNGTNFVGADRYLRDVVNFLNNNQVDIETALSRRGIRWTFSPPGCPHWGGIFEAVVKSAKTHLMRVIGQTSLTFEELTTVFCKIEAVLNSRPLCPLSSDPNDLESLTPGHFLIGQPLNALPEYPLSDIKPGRLRRYQMLQQMSQDFWKRWSLEYLHLLQQRFKWTDRTSPPHVGDLVLVKDANLPPLRWRRGRIVNLFPGKDGTPRSAEVLVGDSVLKRAVTTLSRLPVD

Summary

EMBL
LNIX01000063    OXA37199.1    GEZM01054765    JAV73413.1    GECZ01006169    JAS63600.1    + More
GL442026    EFN64015.1    LNIX01000002    OXA60848.1    LBMM01012392    KMQ86241.1    JXUM01030959    KQ560903    KXJ80414.1    LNIX01000005    OXA54454.1    LNIX01000069    OXA36894.1    ABLF02039606    LNIX01000016    OXA46198.1    GEBQ01018232    JAT21745.1    LBMM01009403    KMQ88162.1    ABLF02027568    ABLF02027570    ABLF02027572    ABLF02066092    LBMM01006099    KMQ90942.1    QOIP01000010    RLU18065.1    GEZM01018697    JAV90052.1    GDHC01018560    JAQ00069.1    OXA59522.1    LBMM01009202    KMQ88311.1    LNIX01000007    OXA51795.1    GGMS01009443    MBY78646.1    GEZM01039657    JAV81297.1    GBHO01023090    JAG20514.1    LNIX01000036    OXA39969.1    ABLF02035110    ABLF02067347    LBMM01009888    KMQ87813.1    GGMR01013370    MBY25989.1    LBMM01009941    KMQ87772.1    GGMR01000737    MBY13356.1    GEBQ01029803    JAT10174.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GGMS01016125    MBY85328.1    GGMR01014165    MBY26784.1    GEZM01018702    JAV90048.1    GBHO01034064    JAG09540.1    LBMM01018894    KMQ83668.1    GDHC01021148    JAP97480.1    GBHO01023589    GBHO01023588    JAG20015.1    JAG20016.1    LBMM01009898    KMQ87805.1    LBMM01009746    KMQ87900.1    LBMM01009964    KMQ87756.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    ABLF02013940    ABLF02036313    ABLF02066938    ABLF02066950    ABLF02013233    GEZM01085145    GEZM01085143    JAV60187.1    GBHO01007402    GBHO01007399    JAG36202.1    JAG36205.1    GEZM01021505    JAV88969.1    KQ459256    KPJ02096.1    GGMR01005535    MBY18154.1    GGMR01015135    MBY27754.1    GALX01004947    JAB63519.1    GGMR01005823    MBY18442.1    KQ460211    KPJ16510.1    LNIX01000026    OXA42260.1    IAAA01034021    IAAA01034022    LAA09083.1    ABLF02008636    ABLF02065931    GEZM01066272    JAV68024.1    ABLF02005684    LBMM01009551    KMQ88039.1    LBMM01006490    KMQ90572.1    LBMM01006671    KMQ90403.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GDHC01006469    JAQ12160.1    GGMR01020500    MBY33119.1    GDHC01006567    JAQ12062.1    ABLF02030854    ABLF02033054    ABLF02041670    ABLF02017056    GEDC01022769    JAS14529.1    IAAA01051064    LAA11179.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    ABLF02041614    GBBI01004386    JAC14326.1    GGMR01010723    MBY23342.1    GBBI01004387    JAC14325.1    GBHO01045636    GBHO01045635    JAF97967.1    JAF97968.1    LBMM01012188    KMQ86362.1    GALX01005107    JAB63359.1    QOIP01000009    RLU19130.1    QOIP01000012    RLU16284.1    GDHC01002235    JAQ16394.1    GEBQ01015458    JAT24519.1    GEZM01103137    GEZM01103136    JAV51536.1    ABLF02006304    ABLF02036268    RLU15928.1    LBMM01009688    KMQ87939.1    GEBQ01000825    JAT39152.1    GEZM01068861    GEZM01068860    JAV66730.1    GGMR01016490    MBY29109.1    KQ977096    KYN05838.1   
Pfam
PF05380   Peptidase_A17        + More
PF00665   rve
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF03564   DUF1759
PF00078   RVT_1
Interpro
IPR012337   RNaseH-like_sf        + More
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR005312   DUF1759       
IPR001878   Znf_CCHC       
IPR000477   RT_dom       
IPR001969   Aspartic_peptidase_AS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR000727   T_SNARE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
Gene 3D
PDB
4BAC     E-value=0.0405178,     Score=88

Ontologies

Topology

Length:
638
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01379
Exp number, first 60 AAs:
0.00101
Total prob of N-in:
0.00056
outside
1  -  638
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
-1.585846
CLR
4503.366845
CSRT
0
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号