SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12146
Annotation
ORF_A_span_522-1895
Location in the cell
Nuclear   Reliability : 2.031
 

Sequence

CDS
ATGGCCGTAGACCCGGACCAAATCTACAAGGCCCTTCGCCCAGTGCCAGAGTTCGACGGCAATCCGAACATACTGACTAGGTTTATCAGAATTTGTGACCAAATCGTCACACAGTATATAAGAACAGATCCTGGCAACGAATTAAATAACCTCAGCTTAATAAATGGTATATTAAATAAAATAACTGGTCCTGCCGCCAGGACCATAAATTCAAATGGCATACCAGAGAACTGGTTAGGTATCCGTACTGCCCTCATTAATAATTTTTCAGATCAAAGAGATGAGACCGCTTTATACAATGACCTCTCCTTACTAACACTGGCAAACAATAATGATCAGATCAACGGACAGCCTCTGAAAATAACTGAAATCCCGAAGGATGCAAAAATCACAGGACCCATTAGACCTCATATCAAGCTCACCTCCTTGAACCTGGAGAAAATACACCAAATCCAAGATGATATAATCCAACAACATCCTGTGGACCTAGAACAAAGTGACGTCACGAACCAAGCACTCTTTCATAGGACAATACCCTTTTACGGAGCACTCTGCGGCGCGATTGTCCTAGCTGTTGTAATCGCTGTTCATCAGCACAAGTCTTGCAACATAACCCTGGAAAAGAAGCCACGCGAAGAAACCTCAAAATTTCACCCGTACGAGAGTCCAGAAGAACCCCAGAAGAAGGACCGAATTCCGGCAACATTTGCCCTCAAGATTATCAAATAG
Protein
MAVDPDQIYKALRPVPEFDGNPNILTRFIRICDQIVTQYIRTDPGNELNNLSLINGILNKITGPAARTINSNGIPENWLGIRTALINNFSDQRDETALYNDLSLLTLANNNDQINGQPLKITEIPKDAKITGPIRPHIKLTSLNLEKIHQIQDDIIQQHPVDLEQSDVTNQALFHRTIPFYGALCGAIVLAVVIAVHQHKSCNITLEKKPREETSKFHPYESPEEPQKKDRIPATFALKIIK

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
242
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
19.48151
Exp number, first 60 AAs:
0.00406
Total prob of N-in:
0.35545
outside
1  -  176
TMhelix
177  -  196
inside
197  -  242
 
 

Population Genetic Test Statistics

Pi
232.240565
Theta
200.405745
Tajima's D
0.382913
CLR
13.29384
CSRT
0.472576371181441
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号