SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12143
Pre Gene Modal
BGIBMGA004257
Annotation
hypothetical_protein_ALC57_15604_[Trachymyrmex_cornetzi]
Location in the cell
Nuclear   Reliability : 2.905
 

Sequence

CDS
ATGGCTTCGATACGAGAACGTTCATTTTCATCACAGCTACTGTTGGGCCTTTCCGTATTTCTTCACAGAAGATATGGGTCTAAAAAATTGTTGGATGTTTTATCATCTTTAGGATTTGCTGCATCATATAATAATACCATACAGTATGAAGTTTCAGCAGTTTACCATCCACAACCTCGTATTTTACCATCAGAGTCTGGTGCGTTGGTACAATATGTTGGAGACAATGCAGATATTAATGTCAGTACTCTTGACGGTAATAATACTCTTCACGTTATGGGAATGATAAAAATAATTACTCCGAAAGATGCTGTAATTTATGATGATCGCATAAAAAAATGTACAACTAAACCGAGTGCAAAAGAGTTAGCAGCAATATCACATGTATCTCTTTTAGCATATGAAAAGCCAGTTGTACCTGGGTACAGCAAGATTCAAGTCCAAAATCTACATGATGATCAAGTACTGATTGAAAAAAAATTTAATGCAGTTGATTTGTTGTGGTTATACGGAAAATGGAAGAATCTTTCACCGTTGCCAGGGTGGAATGGCTATCTTCAACAACTTACGAAAAATAATCAAAATTTTTCAACTTCTCAGGTTATATTTCTACCTTTCATTGATCATCCTGCCAGTAATTTAGACACAATTTATACAACTTTACATAGTGCTATAAATATTGCCAAGTCACATCAACAAAAAACGTGCATAATTACATTTGATCAGCCCCTGTACTCAAAAGCACGTGAAATGGTTGCTGCGTCAGATGCAAACTCAGACTTGTCTAAAACAGTTGTCAAACTTGGAGGATTTCATATGCTCATGTCTTTTCTTGGATGCATAGGACATGTAATGGACGGTAGTGGTCTCAAGGAAGCTTTAAGTAAAATATATGCTACAAATTCGGTCGACAAAATGTTGAATGGTCACGCTTATGCAAGAAGTATCAGAGGCCATATATTATTACGACTTGCATTATCAATAAAGATTTTTGAAGAGATGAAAATTGAAAATTGTGTGTTAGATGAGTTAATTGAACAGATAACTAGTCGCGATGTTTCCTACGAAGATGTTGAAGGATGTACGAGCAGCTCCAACTCGTTAATTGATCAATTTCAGGATAAACTAAAAGAATTAAAAGCTCGAGGTCCCACGGCACAGTTATGGGTGCAATATTTTGAAATGGTATCAATAGCCCTAGATTTCATTCGCGCTGAAAGGCTGGGACTTTTTCAAGAACATTTGGATGCAGTGCGAAAAATGCTGCCCTATTTTCATGCTGGTGGTCATTTCCTATATGCGAAGTCAGCTCATTTGTATCTTCAAGATATGTTAAAACTTGAGGAGACAATGGATCAACAGGTTTTTGAGAACTTTAAAAACGGATTCTTTACTGTAAAACGAACAGAAAAATTCAATTCTGGTACATGGACAGACATGGTAATCGAGCAAAGTCTGATGAAATCTATGAAGACAGAAGGAGGAGTATCTCGAGGCCGAAGTACACAAGAAAGTGTTCTATGTAAGTGGGTATATGCTATGTATGCCACGAATACAATTTGTGAAGAAATTGAACGGTTTTGTAACATTTCTTTCGATTCTGTGGACCAACATGTTGATGCTAGAGATTCACGAATAAAAAGGGATGATACTGATGTAAATGAACTGGTTGGTTGGTTTACGCTTCATAATCCCTTTCCAAATGCGAATCAGTTGGTATCCTTAGCTTCAGGAATCGTTGGAAATGACCAAATTCATTGTTACCGAGCCCATGAAATCGGATTGCAATCTATGGTAAAGATAACTGGTTTGAACTTCAACGAAATAAAGTTAAAACGCGTCGATAAGGTTTTACCGCTTTCAGCCATTAACAAATCTGTCAAAATTAATGATTGTAAAGTTTCTATAGATCCAATGTTACTTTTCCAGAGAATAACTGTAAGCAAAAAATTTGAAAGTAATTTACAAGAATATCTTCAGTATGAACTAAGTCCGTATCCGACATCTTTATTTGATAGTAATGGCATGAGAAAAACCACGAAAGCAACATTATATGACAATATGATGCCTGTCGTTATCGATCTTGATGAAAATAATGTAACATACATCATCGATGGTGGATTTCTTCTGCATCGCGTCGTATGGAGCAAAGACGATACTTTCTCTATTATTTTAAATAAGTACATTAAATATTTACAAACACATTATGGCTCAGCAATTGTTGTTGTATTTGACGGATATTCGGACTATAGTAAAAATATTAAAGCACTGGAACAACAAAGAAGAACTGCTGCACTTTCAAAATCATATGAAGTTTGTTTTGACGAAACAATGGTTGTGCCAATCAGTCAAGAAATTTTTTTATCAAATCGGTCTAATAAAAAAAAATTTATCGACATGCTTGTTGAAAAATTTAAAACTGTTAATATCACAACAAAACAAGCCAGAGATGATGCTGATGTTCTCATCATTGACACAGCTATTGCCTTATCAGAACATCAAAAGACTGCTGTCATCATAGGAGAAGATATCGATTTGCTCGTTATTTTAATTGGACGTACTCATTCACATCATCAGGAAATTTTTTTGAAAAAAGTTGGCAAAGGCAATGTCAAAACACAAATATATTCTACTAAAAGTTTCGACCAATATCCTCGTACTAAAAAGCACATTTTATTTTTACACGCATTCAGTGGCTGTGACACGACTTCTGCGCTATTTAAAAAAGGAAAAAAAACTGTTACTAGAGCATTGGAAAAAATTCCTGATTTAGATAAACTGGTGGAAGTATTTCAACAAGAAAACTGCCCAAAACAAACATTATTAGAAAATGGAGTGCGCATCTTGTTGGCATTATATAATGCTCCAAAATCTGAGGACAACATTGATCATTTCCGCTACACGCAATTCATCAAATTTACAAAACTAAATAAACCTGTACAACTGTCAACACTTCCACCAACAAGTGTAGCAGCTCATCAACACATAAAACGTGTCTACTACCAGATTCAAACGTGGTTAGGGAAGGACTTAGAACCTCAAGAATGGGGCTGGATGCTTGAAAATGAAATCCTGGAGCCCATACGAACGTTATTACCTCCAGCACCAGCCGAACTACTAAACGTAATATTTTGCAATTGCAAAAATGGTTGTGGTTCCCGCTGTGGATGCAGAAAATCAGGGCTACAATGTTCTTTAGCTTGCGGCCAGTGCAACGGACAAGCTTGCCTCAACGCTTCACTGTATCCAAGTAATCCCGATGAAGAAAATACATATGATCCCGATATTCTCGAAGGTTTGGAGATGAACATGACAGATAATGAGGATGATGACAATGAATCGAACATTTTTGAGCGACAAGAAGAAGAAGACAACGAAGAAGAAGAAGATAATTAG
Protein
MASIRERSFSSQLLLGLSVFLHRRYGSKKLLDVLSSLGFAASYNNTIQYEVSAVYHPQPRILPSESGALVQYVGDNADINVSTLDGNNTLHVMGMIKIITPKDAVIYDDRIKKCTTKPSAKELAAISHVSLLAYEKPVVPGYSKIQVQNLHDDQVLIEKKFNAVDLLWLYGKWKNLSPLPGWNGYLQQLTKNNQNFSTSQVIFLPFIDHPASNLDTIYTTLHSAINIAKSHQQKTCIITFDQPLYSKAREMVAASDANSDLSKTVVKLGGFHMLMSFLGCIGHVMDGSGLKEALSKIYATNSVDKMLNGHAYARSIRGHILLRLALSIKIFEEMKIENCVLDELIEQITSRDVSYEDVEGCTSSSNSLIDQFQDKLKELKARGPTAQLWVQYFEMVSIALDFIRAERLGLFQEHLDAVRKMLPYFHAGGHFLYAKSAHLYLQDMLKLEETMDQQVFENFKNGFFTVKRTEKFNSGTWTDMVIEQSLMKSMKTEGGVSRGRSTQESVLCKWVYAMYATNTICEEIERFCNISFDSVDQHVDARDSRIKRDDTDVNELVGWFTLHNPFPNANQLVSLASGIVGNDQIHCYRAHEIGLQSMVKITGLNFNEIKLKRVDKVLPLSAINKSVKINDCKVSIDPMLLFQRITVSKKFESNLQEYLQYELSPYPTSLFDSNGMRKTTKATLYDNMMPVVIDLDENNVTYIIDGGFLLHRVVWSKDDTFSIILNKYIKYLQTHYGSAIVVVFDGYSDYSKNIKALEQQRRTAALSKSYEVCFDETMVVPISQEIFLSNRSNKKKFIDMLVEKFKTVNITTKQARDDADVLIIDTAIALSEHQKTAVIIGEDIDLLVILIGRTHSHHQEIFLKKVGKGNVKTQIYSTKSFDQYPRTKKHILFLHAFSGCDTTSALFKKGKKTVTRALEKIPDLDKLVEVFQQENCPKQTLLENGVRILLALYNAPKSEDNIDHFRYTQFIKFTKLNKPVQLSTLPPTSVAAHQHIKRVYYQIQTWLGKDLEPQEWGWMLENEILEPIRTLLPPAPAELLNVIFCNCKNGCGSRCGCRKSGLQCSLACGQCNGQACLNASLYPSNPDEENTYDPDILEGLEMNMTDNEDDDNESNIFERQEEEDNEEEEDN

Summary

Pfam
PF03564   DUF1759        + More
PF05585   DUF1758
Interpro
IPR029060   PIN-like_dom_sf        + More
IPR005312   DUF1759       
IPR008737   Peptidase_asp_put       
IPR007527   Znf_SWIM       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR011011   Znf_FYVE_PHD       
SUPFAM
SSF88723   SSF88723        + More
SSF56219   SSF56219       
SSF57903   SSF57903       
Gene 3D

Ontologies

Topology

Length:
1131
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.16343
Exp number, first 60 AAs:
0.05212
Total prob of N-in:
0.00791
outside
1  -  1131
 
 

Population Genetic Test Statistics

Pi
227.224003
Theta
165.30382
Tajima's D
1.419341
CLR
0.658375
CSRT
0.772411379431028
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号