SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12142
Annotation
Yokozuna_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.208
 

Sequence

CDS
ATGCATTCCGATACCGAACAAGACTTTTATGCTGTTTCAAGATTCCCACGTGTCCTTGGTACACTTGATGGTACACACATTAGGATTCAGTCACCATGTTCTCAGATTGAAGAAGAATTTAGAAACCGAAAAGGTTACTTTTCCCTTAATGTCCAAGCTGTGTGCAGCAATGCAGATTTATTATTTATGAATGTGGTGGCTCGTTGGCCAGGTTCAGCTCATGATGCCACAATATTTAATAATTCAGACTTGCGAGCTCAGTGTGAAAATGGCTCATTTGGAAATAAGTGGTTACTTGGAGATAGTGCTTATCCCTTGAAGCCATATTTATTAACGCCACTAATTAACACACAGACACGGGGCCAACAGCTTTATAATGAAGCCCATATTCGAACAAGAAACTGCATTGAAAGATGTTTTGGAGTTTGGAAACGAAGATTCCCTGTTGTAGCCTTAACATTGCGCCTGAGCCTTCTAAGAGCGAATGCAGTGATTATAGCTACAGCTGTACTCCACAACATTTGTCGACTGAAGAAGCTTGATGATATATCACCAGAAGTAGAAATTCCTGAGGCAGATGTGTTACCTACAGAAAGTAGCACTGAGGAAACTTTTAAGGAAAAGGAATGCAAAGAAGCAATTGAAGATGGCATAACAGAGGAAATATTGAAGTCAGAAAAATTCAAAAAGAAAGACGCAAAAGCTAGAAGTTTGATAGTCAACTGCCTCTCAGACAAACACTTGGAATACGTCAGAAGCGCTACGAGTGCAAAAGAGATGATCGAAAACTTACGAAAAATATTCAAAAGAAAAAGTACGTTATCTGCGTTATACGTCAGGAAGAAATTATTAACCTTAAAATGTGACCCCAGTGTCGAACTGAGCGACCACTTCAACAATTTTGATATGTTAATAAGACAATTAGAAGAAACTGGAAGCACAGTAAATGAACAAGACAAGGTGTGCCACTTACTACTGACTATGCCTGACAGCTACAATACTACAATTGCCGCCTTAGAAACTACTAATGTGGAACTTACAACAGAGTATGTCAAAAGCAAATTGTTAGATGCAGAACTAAAAAACCAAAATAATTCAATAGAATCACAGGATGCACACAGCTTCCTCAGTTGCTTTAAATGTGGTAAAACTGGTCACAAAGCTATACAGTGCAGAACTGGACACTTAATGAGAGGACAGCATCGAGGCAAAATGGGCAACGTCGGATATTTCAACGGAAGTAACACTAGAGACTTCTATCGAGGCAACGGCAGAGACTTCAATCCAGGTAACGGCAGAGGCTTTAACCGAGGCAATCCCAGAGGCAACGTGAGAGGACAATCGAGGGGATCATCAAGGGACATCATACCCCAACAAGGAAAAAGTGCTTTAAGTGAGAGAAATCCATTTTCTTTTGTTGCCAGTGAAAAGGTACTATCTGTTGATGTGTATAATGAGGACATTAAGTTTATTATTGATTCAGGAGCATCTCAAAATTTAGTCATTGATAGTTATGAAAAGTACATGTCAAACATTGAATATTTAGAAACTAAAACTAAGATTTATGTTGCTAATGGTCAATATTTGTTTTCAAGTAAAAAAGGGATTTTAAATGTAAAATATAATAACTTACCTATTAAAATAGAAGCACTACTTGTCAAGGGGCTATCCCACAACTTATTATCTGTTAAAAAATTATTAGAGAAAGGAAATTCTGTCAGATTTCATAAAAATTCTGTATCAATTGCTAAAGGAAATAACATAATTTATGGTACCATGCTTAATAGTCTGTATGCAATCAATCTTACATTAAACTTAGAAAAATGTTATTCGATAAACAATGATAAAGATCTATGGCATAAAAGGTTAGGACATGCTAATAGAAAACACTTAAAATTATTGAAATTACCTATCTCAGAAAAACCATGTGGAATATGTGTAGAAGGAAAATCAACAAGATTACCATTCTCTACAACACCCAGGCCGAGATCAAAATATATAGGAGAACTCATACACACAGATATATCAGGACCAATAAATATTCCTACACTTACAAATGAGGTATATTTTCATACAATTATAGATGATTACACACATTTCTGTGAGGTATACTTATTACAAAGAAAAAGTGAGGCAACCGATAGGCTCATAGAATATGTTAATAGAATGGAAAGACAAATAGAATGTAAAGTCAAGAAAATCAGAAGTGATAATGGTGGTGAGTTTAAAAATGAAAAACTAAATAAATTTTGCAAAGATAAGGGAATAGTTCAACAGTTTACTTTGCCTTATAGCCCACAGTCAAACGGAGTTTCAGAACGCATGAACAGAAATATTTATAACAGAGCTCGAACTTTATTAATTGAATCTGGTTTACCAAAAACCTTATGGGGTGAAGCGGTGCGATGTGCTGTCTATCAAACCAATAGATGTCAATCGTATGCTATCAACTTTCAAACCCCAGCAGAGAAAATGTTTGGAAACAAAGACTTAACAAGACTTAGGATATTTGGATCAAAATCATGGGTTCATATCATACCAAAACAAGATAAACTTTTACAAAGAGCTAAAGAAATGAGACTCGTAGGATATAGCCCAAATGGATATCGTCTATGGGACCCTACAAGTAATAAAGTGATAGTGTCAAGAGATGTCAGAATTGATGAAACGCAATTAAACTACAAGGAAACTGAAGAAAAGCATAACATAAAAGGAGAAACGTACTATGAAGATGAATTAATACAAAATGACGATACTGAGAAGGACACAGAAGCTGACCAAGAGACAAGAATACCTAATGAGAATGATGAAAACATGCAACATGATAGAATACCTGATAAAACAAATAAAGAAGTATCAAAGAATAATCAAGATGATGAAGAAGAAAATGTAAAATTGAATAAAAAAGGTAGAATAAATATACAGAAATATATAACAAGATCAGGAAGAGAAATTCGCAAACCAAAAAACTTAGAAAAATATGATCTAAATATAGCATACTGTCTTTTATCGGGAGACCCACAAGAATTTGAAGATGCAATTCATAACAAAGACTGGGAAAAAGCAATAAAGACAATTAAATTCACAAGTGAAATTAGAGACATGGGAAGAAGCTACATTACCAATGGGAAGTAA
Protein
MHSDTEQDFYAVSRFPRVLGTLDGTHIRIQSPCSQIEEEFRNRKGYFSLNVQAVCSNADLLFMNVVARWPGSAHDATIFNNSDLRAQCENGSFGNKWLLGDSAYPLKPYLLTPLINTQTRGQQLYNEAHIRTRNCIERCFGVWKRRFPVVALTLRLSLLRANAVIIATAVLHNICRLKKLDDISPEVEIPEADVLPTESSTEETFKEKECKEAIEDGITEEILKSEKFKKKDAKARSLIVNCLSDKHLEYVRSATSAKEMIENLRKIFKRKSTLSALYVRKKLLTLKCDPSVELSDHFNNFDMLIRQLEETGSTVNEQDKVCHLLLTMPDSYNTTIAALETTNVELTTEYVKSKLLDAELKNQNNSIESQDAHSFLSCFKCGKTGHKAIQCRTGHLMRGQHRGKMGNVGYFNGSNTRDFYRGNGRDFNPGNGRGFNRGNPRGNVRGQSRGSSRDIIPQQGKSALSERNPFSFVASEKVLSVDVYNEDIKFIIDSGASQNLVIDSYEKYMSNIEYLETKTKIYVANGQYLFSSKKGILNVKYNNLPIKIEALLVKGLSHNLLSVKKLLEKGNSVRFHKNSVSIAKGNNIIYGTMLNSLYAINLTLNLEKCYSINNDKDLWHKRLGHANRKHLKLLKLPISEKPCGICVEGKSTRLPFSTTPRPRSKYIGELIHTDISGPINIPTLTNEVYFHTIIDDYTHFCEVYLLQRKSEATDRLIEYVNRMERQIECKVKKIRSDNGGEFKNEKLNKFCKDKGIVQQFTLPYSPQSNGVSERMNRNIYNRARTLLIESGLPKTLWGEAVRCAVYQTNRCQSYAINFQTPAEKMFGNKDLTRLRIFGSKSWVHIIPKQDKLLQRAKEMRLVGYSPNGYRLWDPTSNKVIVSRDVRIDETQLNYKETEEKHNIKGETYYEDELIQNDDTEKDTEADQETRIPNENDENMQHDRIPDKTNKEVSKNNQDDEEENVKLNKKGRINIQKYITRSGREIRKPKNLEKYDLNIAYCLLSGDPQEFEDAIHNKDWEKAIKTIKFTSEIRDMGRSYITNGK

Summary

Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13961   DUF4219
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
Gene 3D
PDB
5UOQ     E-value=4.92891e-08,     Score=141

Ontologies

Topology

Length:
1044
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.00239
Exp number, first 60 AAs:
0.03724
Total prob of N-in:
0.04510
outside
1  -  1044
 
 

Population Genetic Test Statistics

Pi
297.791392
Theta
175.864807
Tajima's D
2.044731
CLR
12.270604
CSRT
0.886555672216389
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号