SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12128
Pre Gene Modal
BGIBMGA014357
Annotation
gag-pol_polyprotein?_partial_[Lasius_niger]
Full name
Retrovirus-related Pol polyprotein from transposon TNT 1-94      
Location in the cell
Nuclear   Reliability : 3.662
 

Sequence

CDS
ATGGGCCCAGGACCCGAGACTGCTCAGACAGAACCAGAGACTCCAGAACCAGGACCCCAGACTGTCCAGAACCAGGACCCGAGACTGCTCAGAAAGGACCCGAGACTCCAGAACCAGAACCAGACTGCCCAGAACCTAGCACAAAACCTTTTGTCTGTAAATTGTATTACCAACAATGATGGTTCTGTTGTGTTCACAAAGAATAAAGTGGAGATTTACAAAAATTCAAAATTAATTTTAACCGGCAAAAAAGAAAATGGCTTATACAGGGTGAATTTAGTACAAGACCTGAAAAATGAAAATAAATCCTTACTTACACAAGTAAACGGAACAGCATTGGAATGGCATGCAAAATTGGGACACCCAGGTAAATCAGTACTAGAAACACTAACAAAAGTGGCAGACGGCATTAATATACAAGGACCAAAAGTATTACAAGAACAGTGTAAAATATGTGCTGAAGCAAAACAGTCAAGACTACCATTTAATACAATCAGAACTCGTGCTGAAAGGTACCTACAAATAATACACACAGACATATGTGGTCCCTTCGAGGAAAAAACTCATGATGGATATAGATATGTTTTAACAATAATGGACGACTACAGTCATTTTACAAAAATCTTTTTACTTAAAAACAAGAGCGATGCAAAAGCAGAAATTAAAAATTATATTGAAGAAACGGAGCGAGAGAAAAATAGTAAAGTATCAATTATAAGATGCGACAATGGAGGTGAATATACAAGTAATGATTTTAAAGCATTTTGTCAACAAAAAGGTATAAAATTAGACTACACAGTGCCCTACTCACCACAATTAAATGGAAAAGCTGAACGCCTAAACCGGACATTATTAGAAAAAACAAGAGCATTACTCTTTGATTCTAAATTGAACAAAGAAATGTGGGGTGAAGCAATATATTGTGCTACTTATATTTTAAACAGACTACCAAGTGATGCCCTAAAAAACAAAACACCATATGAAATGTGGGTTGGAAAAAAGCCTAATATATCTAATATGCAAAAGTTTGCAAAACGGTTACATCCAAATGTAAAGAAACTGGATCCTAGAAGCAAGAAACTGATAATGATTGGATACACTAATAATGGGTACAGACTGTGGAATGACAAGGAGAGAAAAATAGAGATATCAAGGGACATAGTGATAGTAAAAAGTGAAACTGAACAAAAGAAAGAAAACTATAAGAAAATAAATAATAATAAAAGTGAAAATGATGAAAAAGAGACAACAGAAAACCAGGAAGAGACTGTAGACAACCAGGAAGAGACAACAGAAAACCAGGAAAAGACAACAGAAGATACCAGAACAGAAGAAAATAAAAATGATGAGACTTATGAAGATGTAGTATCAGAAACTGAATCAGAAGACACACAAAGAGAAAGAAACAGACAGAATGAAGAAAACGGTTACCTAAGAAGAAGCAAGAGAATTAGACACATACCAATACATTTAAGAGACTACAGTTTACTTACTTACAGAGAGGCTGTAACATCTAAAGAGGGAGAAAACTGGGAGAAGGCCATAAATTCGGAGAAGGAATCCCTGGAAATCAATAATACCTGGGAAATAGTAGACAAGAAAGAGGCAAAAGATAGTAAAATACTTACAAACAAATGGGTATTCCGTGTGAAAGATAATGGGACTTATAAAGCTAGACTTGTTGTACGAGGATTTGAACAAAACAGTATTGACTACAATGAAATATACAGTCCAGTTGTCAGTCAGTCAACTTTAAAATCTTTATTTGCACTTGCTGCTTCTAAAGACTATAATATGATGACATTTGATGTTAAGACTGCATTTTTATATGGAGAGCTGGAAGAAAATGTGTATATGAATATACCGGATGGTTATGAAAAACAACCTGGGAAAGTTTGTCGATTAAAGAAATCCTTATATGGACTAAAACAAGCTCCTATTACATGGAACAAAAGATTTACAAAAGCAATGTTAAAACTTGGTTTAAAAGCTACTAAAACAGATCAGTGTGTATTTACAAATGAAGATAATACAATAATAATAGCAATCTATGTAGATGATGGACTTGCTTTGGCTAAAGAAAAGCAAACATTAAAAAACATTTTAAACTGCCTAGAAAAGGAATTTGAAATAAAAGTATACAATGATCCTACTACTTTTATTGGATTTGAAGTCAAGAAGACTGAGAAAGGTATAACACTGAAACAAGAAAGCTACATTGGAAACTTATTAAAGAAATTCAGTATGGAAGATTCTAAACCTGTTAAGACTCCCTGTAACACAGAAAATAAAACAGAAACGCAAAACACAGATTCTATAAATTTTCCATATAGAGAACTGATTGGAGGACTTCTATATATATCTACAAGAACAAGACCAGACATAAGTCAAGCTGTAAATGAAGCAAGCAGAAAAATAGAAAACCCTACAAAAGATGATGTGATAGCTGCAAAGAAAATACTAAAATATTTAAATGGAACAAGACAGAAAGGAATCATGTACAAGAAAGGAGGAGATATGTCAAAACTAAATGCATACTGTGATGCAGACTATGCCAATTGTATCAAGACAAGACGCAGTACAACCGGATTTGTGATAATGTTAGCAGAAGGACCTGTGTCTTGGTGTTCAAAACGACAACCAATCGTTGCATTATCATCAACTGAAGCAGAGTATATTGCAGCAGCTGATTGCTGTAAGGAATGCTTATATTTAATGTCATTTTTAAAGGAGTTGATTGGTTCTGAAGTTGAAGTTACATTAAATGTTGATAACCAAAGTGCTATTCAGCTGATCAAAACAGGAGAAGGTGTTAGTGGGTACATCCCTATTAAGAAGCTGTATGTAGCACGACACTAG
Protein
MGPGPETAQTEPETPEPGPQTVQNQDPRLLRKDPRLQNQNQTAQNLAQNLLSVNCITNNDGSVVFTKNKVEIYKNSKLILTGKKENGLYRVNLVQDLKNENKSLLTQVNGTALEWHAKLGHPGKSVLETLTKVADGINIQGPKVLQEQCKICAEAKQSRLPFNTIRTRAERYLQIIHTDICGPFEEKTHDGYRYVLTIMDDYSHFTKIFLLKNKSDAKAEIKNYIEETEREKNSKVSIIRCDNGGEYTSNDFKAFCQQKGIKLDYTVPYSPQLNGKAERLNRTLLEKTRALLFDSKLNKEMWGEAIYCATYILNRLPSDALKNKTPYEMWVGKKPNISNMQKFAKRLHPNVKKLDPRSKKLIMIGYTNNGYRLWNDKERKIEISRDIVIVKSETEQKKENYKKINNNKSENDEKETTENQEETVDNQEETTENQEKTTEDTRTEENKNDETYEDVVSETESEDTQRERNRQNEENGYLRRSKRIRHIPIHLRDYSLLTYREAVTSKEGENWEKAINSEKESLEINNTWEIVDKKEAKDSKILTNKWVFRVKDNGTYKARLVVRGFEQNSIDYNEIYSPVVSQSTLKSLFALAASKDYNMMTFDVKTAFLYGELEENVYMNIPDGYEKQPGKVCRLKKSLYGLKQAPITWNKRFTKAMLKLGLKATKTDQCVFTNEDNTIIIAIYVDDGLALAKEKQTLKNILNCLEKEFEIKVYNDPTTFIGFEVKKTEKGITLKQESYIGNLLKKFSMEDSKPVKTPCNTENKTETQNTDSINFPYRELIGGLLYISTRTRPDISQAVNEASRKIENPTKDDVIAAKKILKYLNGTRQKGIMYKKGGDMSKLNAYCDADYANCIKTRRSTTGFVIMLAEGPVSWCSKRQPIVALSSTEAEYIAAADCCKECLYLMSFLKELIGSEVEVTLNVDNQSAIQLIKTGEGVSGYIPIKKLYVARH

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Aspartyl protease   Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Protease   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger  
Feature
chain  Retrovirus-related Pol polyprotein from transposon TNT 1-94
EMBL
GBHO01024362    JAG19242.1    GBHO01040573    JAG03031.1    GBHO01040574    JAG03030.1    + More
GECL01003258    JAP02866.1    GBHO01035869    GBHO01006095    JAG07735.1    JAG37509.1    LBMM01012772    KMQ86003.1    GBHO01035865    JAG07739.1    GBHO01006096    JAG37508.1    GBHO01012744    JAG30860.1    GECZ01019212    JAS50557.1    KQ459875    KPJ19636.1    GBHO01024931    JAG18673.1    NWSH01002292    PCG68657.1    PCG68658.1    KQ484038    KYP38095.1    KQ484186    KYP36645.1    CM003607    KYP67664.1    KQ483417    KYP53032.1    FJ544851    ACL97383.1    OIVN01001052    SPC89229.1    KQ483702    KYP42748.1    OIVN01000991    OIVN01001835    SPC88370.1    SPC98114.1    FJ544853    ACL97384.1    NEVH01013252    PNF29308.1    OIVN01002055    SPD00174.1    OIVN01002680    SPD05612.1    OIVN01000557    SPC82046.1    FJ544854    ACL97385.1    FJ544856    ACL97386.1    NCKU01004452    RWS05910.1    OIVN01002904    SPD07378.1    OIVN01003569    SPD12194.1    OIVN01003683    SPD12935.1    OIVN01004867    SPD19656.1    OIVN01001666    SPC96375.1    OIVN01000036    SPC73022.1    OIVN01002516    SPD04274.1    OIVN01002854    SPD06945.1    GBXI01011094    JAD03198.1    OIVN01004379    SPD17029.1    OIVN01001309    SPC92453.1    OIVN01004879    SPD19723.1    OIVN01001022    SPC88819.1    OIVN01005591    SPD23209.1    OIVN01005059    SPD20680.1    AB014676    BAA74713.1    OIVN01003423    SPD11099.1    OIVN01006261    SPD29147.1    OIVN01005024    SPD20514.1    OIVN01005657    SPD23465.1    OIVN01006239    SPD28653.1    OIVN01006233    SPD28466.1    OIVN01001130    SPC90232.1    D83003    BAA11674.1    JN402333    AFB73912.1    OIVN01001534    SPC95017.1    GEZM01078128    GEZM01078127    JAV63002.1    OIVN01004420    SPD17230.1    AAZX01015857    AAZX01019482    OIVN01000183    SPC75833.1    OIVN01006387    SPD32065.1    X13777    OIVN01000313    SPC78143.1    OIVN01002256    SPD02034.1    OIVN01001196    SPC91020.1    JN402332    AFB73911.1    CM007892    OTG31811.1    OIVN01000423    SPC79931.1    GDHC01011760    JAQ06869.1    OIVN01002828    SPD06754.1    CM003608    KYP66486.1    NEVH01006721    PNF37231.1    GEZM01040221    GEZM01040220    JAV80932.1    GEZM01044912    JAV78046.1    AM433482    CAN69340.1    JYDK01000067    KRX78390.1    GEZM01099107    JAV53485.1    OIVN01004307    SPD16591.1    SPC78111.1    OIVN01003897    SPD14257.1    KQ485623    KYP31853.1    OIVN01003473    OIVN01006347    SPD11516.1    SPD31125.1    JYDR01000237    KRY65040.1    OIVN01000116    SPC74628.1    JYDO01000312    KRZ65659.1    OIVN01004603    SPD18338.1    JYDH01000102    KRY32233.1    KRY32232.1    OIVN01002224    SPD01757.1    OIVN01000822    SPC86058.1    PCG68656.1    OIVN01001202    SPC91100.1    OIVN01000073    SPC73751.1    NKQK01000016    PSS08126.1    OIVN01001520    SPC94877.1    OIVN01001890    SPC98658.1   
Pfam
PF13976   gag_pre-integrs        + More
PF07727   RVT_2
PF00665   rve
PF00098   zf-CCHC
PF13961   DUF4219
PF08534   Redoxin
PF00106   adh_short
PF00626   Gelsolin
PF08033   Sec23_BS
PF13855   LRR_8
PF03106   WRKY
PF13456   RVT_3
Interpro
IPR025724   GAG-pre-integrase_dom        + More
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR025314   DUF4219       
IPR036291   NAD(P)-bd_dom_sf       
IPR013740   Redoxin       
IPR020904   Sc_DH/Rdtase_CS       
IPR002347   SDR_fam       
IPR036249   Thioredoxin-like_sf       
IPR037944   PRX5-like       
IPR007123   Gelsolin-like_dom       
IPR029006   ADF-H/Gelsolin-like_dom_sf       
IPR036180   Gelsolin-like_dom_sf       
IPR012990   Sec23_24_beta_S       
IPR032675   LRR_dom_sf       
IPR036576   WRKY_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003657   WRKY_dom       
IPR002156   RNaseH_domain       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF51735   SSF51735       
SSF52833   SSF52833       
SSF82754   SSF82754       
SSF118290   SSF118290       
Gene 3D
PDB
5UOQ     E-value=1.34625e-08,     Score=146

Ontologies

Topology

Subcellular location
Nucleus  
Length:
952
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000870000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  952
 
 

Population Genetic Test Statistics

Pi
323.894712
Theta
175.170881
Tajima's D
2.46262
CLR
0
CSRT
0.943102844857757
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号