SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12121
Annotation
PREDICTED:_serine/arginine_repetitive_matrix_protein_1-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.824
 

Sequence

CDS
ATGTCCCCGGCAGCTTTTTGGCTGCTAAAGGGGAAGGCCCTCCAGAGGAGGGTACCGGTACGCCGGCGTGGCCACACCGTGGTCAGACGTGTGGGTCTGTCAGTAATGGTAGACCCCACGTGGATGAGAAGTGAACCGGAGGGCACTCCCTTCCGGTCGCTGGTTGCCATGTCCCCGGCTGCCTCTTGGCGGCTACAGGGGAAGGCCCCCCAAAGGGGGGTACCGGTTTACCGGCGTGGCTTCGAAGAAGCACACCGCAATCCCTACCGAGTAGGGGACGGGGGCTGCTGCCTAGCAGGAGCCGAGGGTACCACTCTAGGTGGAGAATCCCTCCGTGCTTCCACTTCGGTGGGAGCATGCTGCCCCACGTATTCTGGGGGGGGCAAAGCATGCCACGATGAAGGGGGCTGTGCGACGGGCAGCGGAAAACCCGTCGAACCGAGGGAGACCCGCTCGGGGAAGGGCGCACCGTCACCGGCGCCGTCATCGGCGTCGATGTCTGTCGCCTCGCTGGACGGGCGGACGACAGAAGAGGAGGAGGGCGGTCTTCGGGACCCTGCCTTGGTCATAGGCAGGGCCATGAAGACCGTCAAGTCGTATGCGGCGACCAGTGCCAAAACCAAAGCTGCTGGCCGCAGGCTGCGGGAAGTCGTCTCGCGAGTCTCGAAGGTTCTGCCTTCGGTTGCTTCCGCCAATGACCAGGTGGTGCAGCTGATGGCGGAGAATTTGAGGCTCCGAGCACAGCTACAGGCGCAGCAGCGGCCCGATGGCAAGGTTGCTGCTACCAAGCGGGTAGCCGCGACGAGGTCGTCGCCCGCGTTGCCGCGTGCCGCTGGGTCGCGGACTCCTCCGGCATCTGTGCCGGCGGTGTCGCCGCTGGTCTCCGGGGTCCCTCGGGGTCCCTGTCCCTCAGCGGCGGCTGGCGACCCGTGGCCCGTGCTGCCACCATCGCGCGCGGTACAGCGGCGTTCGCGTCTCCCGTCGCCGCGGTCTAGGGAGGCGACGGCCGTCGAGCGGCAGCAGGGATCCGCGGGGCCACGGATCTTGGGCCTGCCGGAACCGAATTGCTACAGCCTGGACGAGATTATCGATCGCACCGTCCAGGCTGTAATGGAAAGGCTGGGTGGCGGGCTGGCGGCTCTCGAAGCGAAACGTATTGTCGCTGGTGACGCTGAACGGCCTGCGTCTACACATGCCGCGGTGTCGGGTGCTGCAGTGACCCGCTCCACCCCCGTACAGGCTCCAGCTACTAGGGCGGGCCCGGGGCGAGACAGAGCCAAGCGGGGGGGCGGCGCTAACGCGAAGTGCACATCGCAAGCGCCTCAACCCCGTCCGCTGCCCCCGCCCCCGTCTAACATGGACGAGGGGTGGAATGTGGTGGCCCGGCGGGGTGCCAAGAGGGCCGTACCGACAGCTCCCCAAGTGGGTGGAGCACCGGCCACTGCGGCGTCTCAGGCTGCTCCCCAACAGGGTCGAGCGCCTGTGGCCGCCAAGAAAAAGAAGACGAAGAAGAAGTCGACGCGCGCGCCGCGGTCGGCGGCAGTGGTCTTAACGCTGCTGCCGGCCGCCGAGGCCAAGGGCGTGTCATACGGAGATGTAGTCTCCCGGGCGTGCGCGGCTATTGATCTGGACGAGATCGGGGCGGGGGAGGGCCTCCGCTGTAGGCTGACGGCCAATGGGGCCAAGCTACTAGAGTGTCCCGGTGCCGATAGTTCCGGCATCGCGGAGCGTCTGGCGGCGAAGCTCCGTACGGTTCTGCCTGAGGAGGAGGTTCGAGTGCACAGGCCGGTCAAAATGGCTGAATTGAGAGTGACCGGCCTGGACGACTGCACCACTAAGGATGAGGTGGCGGCGGCTATTGCCGCCCGGGGCAACTGCGCCCTGGAGAGTATAACCGTAGGCGAGCTGCGCCTCGGTTATACCGGGGCTGGCTCTGTTTGGGTGCGTTGCCCGGTAGAGACGGCCACCTCCTTGGCTGCTCCTCCGCCCGGGAGACCGTCGGGGGAACCGGGCAGGTTGCGCGTGGGCTGGATAGCGGCCCGCGTGCGCCTTCTCGAACCACGCGCCTGGCGGTGCCTCAGATGCTTCAGCACTGGGCACTGCCTTGCTAAATGCGCGAGTGCCGTTGACCGCAGCGGATTGTGCTTTCGCTGTGGTCAGCCGGGACACAAGGCGGCCGTGTGCTCGGCTGCGCCGCACTGCTTATTATGTGCGGCGGCCGGGCGCAAGGCTGACCACCGGGCCGGGGGCAAGGCCTGCCCTCCGGCCAGCAAGAATGCTGAACGAAATCGGCGCCGCCAAGCTAAGCGGCGTCAAAAGAAGCGGTTGGCCGGGGGAGCACCGGCCGGCACTTTGTCCCCGCTGAGGCTCTTAATGGATCACACCTATCGCTTCCTGCAGGGAAACTTGAACCACTCCGCTGGGGCTCAGGACATGTTGCTCCAGACCATGGCGGAGTGGTCAATTGACGTGGCTGTGGTCGCCGAGCCATACTTCGTTCCCCCAGCGGATGACTGTTGGTTTGGGGACGTTGATGGCTTGGCGGCCATACATATCAGAAGAACCGCGATGGTCCCCCCCCTGGCGATGGTGACCAGGGGCCCCGGGATCGTCGCGGTACAGTTAGAAAATATCGTCGTGATCGGGGTGTACTTTTCTCCGAATCGGCCTACCGTCGAGTTCGAGCGGTTCCTGGACGGGCTAGAGGTGATCGCTCGTCACCTCGCTCCCCGTTCAGTGATACTGGCGGGGGACTTCAATGCGAAGTCTGTCGCTTGGGGTTCCCCATTCACGGACGCTCGTGGTAGGCTGCTGGAGGAGTGGGCGGTCGCGGTGGGCACTGAAGCTCCTGAACAGGGAGCTCCTGGTGGAGGCCTCTATGGTGGCGGCGTGGGCGCCCAAGCGCCCACAACCTGTCGATGTGGAAACCGAGGCCGAATGGTTCCGGGGCGCGATGCACCGCATATGTGA
Protein
MSPAAFWLLKGKALQRRVPVRRRGHTVVRRVGLSVMVDPTWMRSEPEGTPFRSLVAMSPAASWRLQGKAPQRGVPVYRRGFEEAHRNPYRVGDGGCCLAGAEGTTLGGESLRASTSVGACCPTYSGGGKACHDEGGCATGSGKPVEPRETRSGKGAPSPAPSSASMSVASLDGRTTEEEEGGLRDPALVIGRAMKTVKSYAATSAKTKAAGRRLREVVSRVSKVLPSVASANDQVVQLMAENLRLRAQLQAQQRPDGKVAATKRVAATRSSPALPRAAGSRTPPASVPAVSPLVSGVPRGPCPSAAAGDPWPVLPPSRAVQRRSRLPSPRSREATAVERQQGSAGPRILGLPEPNCYSLDEIIDRTVQAVMERLGGGLAALEAKRIVAGDAERPASTHAAVSGAAVTRSTPVQAPATRAGPGRDRAKRGGGANAKCTSQAPQPRPLPPPPSNMDEGWNVVARRGAKRAVPTAPQVGGAPATAASQAAPQQGRAPVAAKKKKTKKKSTRAPRSAAVVLTLLPAAEAKGVSYGDVVSRACAAIDLDEIGAGEGLRCRLTANGAKLLECPGADSSGIAERLAAKLRTVLPEEEVRVHRPVKMAELRVTGLDDCTTKDEVAAAIAARGNCALESITVGELRLGYTGAGSVWVRCPVETATSLAAPPPGRPSGEPGRLRVGWIAARVRLLEPRAWRCLRCFSTGHCLAKCASAVDRSGLCFRCGQPGHKAAVCSAAPHCLLCAAAGRKADHRAGGKACPPASKNAERNRRRQAKRRQKKRLAGGAPAGTLSPLRLLMDHTYRFLQGNLNHSAGAQDMLLQTMAEWSIDVAVVAEPYFVPPADDCWFGDVDGLAAIHIRRTAMVPPLAMVTRGPGIVAVQLENIVVIGVYFSPNRPTVEFERFLDGLEVIARHLAPRSVILAGDFNAKSVAWGSPFTDARGRLLEEWAVAVGTEAPEQGAPGGGLYGGGVGAQAPTTCRCGNRGRMVPGRDAPHM

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=4.52286e-07,     Score=133

Ontologies

Topology

Length:
989
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18479
Exp number, first 60 AAs:
0.00088
Total prob of N-in:
0.00006
outside
1  -  989
 
 

Population Genetic Test Statistics

Pi
125.727721
Theta
118.057571
Tajima's D
-1.302642
CLR
0
CSRT
0.0897455127243638
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号