SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12112
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.192 PlasmaMembrane   Reliability : 1.295
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATTGCTTCCGTTTAGTCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCGTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATCCGTGCGTACGATAGCTCGTACTCTCAAATCGGATACGGTAGTAACCATGCCCCCCTCGAAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTTAG
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPLLPFSPDSIPSPQDTAEAIDIVTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNASIRAYDSSYSQIGYGSNHAPLEGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMIC

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    KQ973412    EFA12510.2    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GBBI01004395    JAC14317.1    GGMS01006359    MBY75562.1    GGMR01018716    MBY31335.1    ABLF02034467    ABLF02008605    ABLF02008608    ABLF02008609    ABLF02008610    ABLF02017023    ABLF02028535    ABLF02028545    ABLF02023911    GBBI01004571    JAC14141.1    ABLF02041767    GGMR01004661    MBY17280.1    GFTR01008256    JAW08170.1    GGMR01000676    MBY13295.1    GGMR01016905    MBY29524.1    GGMR01013409    MBY26028.1    GFTR01008262    JAW08164.1    ABLF02017874    ABLF02027031    GFTR01007929    JAW08497.1    NEVH01006736    PNF36716.1    GFTR01008271    JAW08155.1    GFXV01000908    MBW12713.1    GGMR01003407    MBY16026.1    GFTR01008261    JAW08165.1    NEVH01002556    PNF42024.1    GFTR01008038    JAW08388.1    GFTR01008251    JAW08175.1    GGMR01006491    MBY19110.1    GFTR01008260    JAW08166.1    GGMR01000226    MBY12845.1    GFTR01008151    JAW08275.1    GGMR01012443    MBY25062.1    ABLF02014118    ABLF02014121    ABLF02054790    GGMR01012305    MBY24924.1    GGMS01002992    MBY72195.1    KK119261    KFM75202.1    KF280391    AIE77315.1    AY060438    AAL25477.1    ABLF02016634    GECL01003538    JAP02586.1    GEZM01084969    JAV60363.1    GGMR01012676    MBY25295.1    KK118005    KFM71947.1    ABLF02023551    ABLF02023561    GFTR01008246    JAW08180.1    KK119692    KFM76444.1    NNAY01003095    OXU19992.1    ABLF02037660    GGMR01012283    MBY24902.1    GGFJ01001858    MBW50999.1    GGMR01014053    MBY26672.1    GFXV01002840    MBW14645.1    GBGD01000389    JAC88500.1    GGMR01016296    MBY28915.1    GGFJ01001857    MBW50998.1    GGMR01005022    MBY17641.1    GFTR01008269    JAW08157.1    GGMS01002955    MBY72158.1    GFDL01000006    JAV35039.1    GGMR01020516    MBY33135.1    ABLF02055645   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
IPR036397   RNaseH_sf       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
692
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.74234000000002
Exp number, first 60 AAs:
0.05422
Total prob of N-in:
0.05693
outside
1  -  692
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
774.224729
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号