SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12093  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004277
Annotation
mitochondrial_phosphoenolpyruvate_carboxykinase_isoform_1_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.444
 

Sequence

CDS
ATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCACTAACTTGAAAGCCTTCAAGTCATTCAATCCATCTCCATCATCCATCCAATCACCATGGTTCCTAAGGAACGTGGATCTCCATGATGACCTGGAGCTTGACTCAATCAGTAAGTATAAACAGTCGGCATCACTGCGCTACTTTGAGAAGGCAGCACGACACCAAAACCCTCTTGTCGTGGCCGCCGGAAATTACATACCCGATCCTGTAGACCGAATGGCCATCCCCGAAGACTACGTGAGGAAGACGGCACAATGTGCTCAAGTGGCGATTGGATGCAGCCGCGCCGCCCACCAAACTGCTCTGCGAGGGTCGACGAAGCCTTCCCCACAGCTGACCACTCTCACTCCAAAGGTTCGCGCGTTCGTGGAGCGCAGCGCTGCTCTGTGCCAGCCGGAGCACGTGCACGTGTGCGACGGCTCCGAGACAGAGGCGAGGGCCCTGCTACAGCTGATGCAGCAGCAGACCACCCTCAAACGACTGCCCAAATACGATAACTGTTGGTTGGCCCGGACAGACCCGGCAGACGTTGCCCGGGTTGAATCCCGCACGTTCATATGCTCCGATCGGGAGAGCGACGTGGTCCCCTCGGCTCGCGCCGGCCAGAAGTCCGCCCTGGGGAACTACATCTCCCCCCCGGATTACGAGAAGGCCGTGTCCGACAGATTCCCTGGTTGCATGAGAGGTCGCACAATGTACGTGATACCGTTCTCGATGGGCCCTGTGGGATCTCCTCTCTCGAAGATTGGTGTAGAAATCACGGATTCGCCTTACGTGGTTTTTTCTATGCGAGTCATGACTAGAATTGGAGCGAAGGTTCTAGATATTCTACGTCAAGACGAGCAGTTTGTTCATTGTCTTCACGCAGTCGGATCCGGTGGCACTCCGGGCTGGCCCTGCGACCCTCAGAACATCGTCGTACTCCACAAGCCGGCTAACAACGAGATAGTAAGCTACGGCAGTGGATATGGCGGCAACAGTTTGTTGGGCAAGAAGTGCTTCGCTCTACGTCTGGGATCAGTGATCGCCCGTCGCGAAGGATGGCTGGCTGAACATATGCTTATCGTCGGCATAACCAACCCTCAAGGTAAAAAGCGCTACATCGCTGCTGCTTTTCCTTCAGCTTGCGGGAAGACGAATCTCGCAATGATGACGCCAACACTGCCCGGGTACAAAGTAGAGTGCGTGGGGGACGACATAGCCTGGATGAAGTTCGACAAGGACGGCGTACTGCGGGCCATCAACTCTGAAAACGGGTTCTTTGGAATTGCACCAGCCGCTACGAATCCGATAGCAATGGCGACGGTGTTCAAAAACACCGTGTTCACTAACGTGGCGGAAACACCTGAGGGTGGGGTGTGGTGGGAAGGCATGGGACCAGCTCCGGAGCGCCTCGTCGACTGGAAAGGTCAACCCTGGGACCCCAGCAAGAAAACTCCGGCTGCACATCCAAATTCCAGATTCTGCACCCCGGCAGAGCAGTGTCCCATGATAGACGGTGAGTGGGAGAGCTCGGAGGGTGTGCCGATATCCGCCATCCTGCTGGGCGGCAGACGGCCGGCCGGCGTACCGCTCGTAGTCGAGTCGCGGGACTGGCAGCACGGCGTGTTCATGGGAGCTTCCATGAGGTCCGAGGCCACGGCCGCCGCCGAACACAGCGGTAAAATGGTGATGCACGATCCGTTTGCGATGCGTCCGTTCTTCGGCTATAACTTCGGCGACTACCTGAAGCACTGGCTGTCGATGCCGCAGCCGGGACGCAAGATGCCCAAGATCTTCCATGTCAACTGGTTCCGTAAAGACGAACAGGGTAAGTTCCTCTGGCCCGGTTTCGGCGAGAACTCTCGGGTCTTAGACTGGATCTTACGTCGCTGCGATGGGGAGCCCTGCCACGCCGAGACTCCACTGGGGTACATACCGAGAGCCGGTGCTCTGAATACGGAAAACCTAAGCGCTGTCGACATGAACAAGCTGTTCAGCATACCTAAAGACTTTTGGCTGCAGGAGGCTGACGCCATCGAGAAGTACTTCAAAGAGGAGGTAGGCGAAGATCTACCCAACGAAATGTGGGACGAACTGAACAAGTTGAGGAAAAACATACAAGGCCAAGCTTTAAATTAG
Protein
MTYASVVFAHAARTNLKAFKSFNPSPSSIQSPWFLRNVDLHDDLELDSISKYKQSASLRYFEKAARHQNPLVVAAGNYIPDPVDRMAIPEDYVRKTAQCAQVAIGCSRAAHQTALRGSTKPSPQLTTLTPKVRAFVERSAALCQPEHVHVCDGSETEARALLQLMQQQTTLKRLPKYDNCWLARTDPADVARVESRTFICSDRESDVVPSARAGQKSALGNYISPPDYEKAVSDRFPGCMRGRTMYVIPFSMGPVGSPLSKIGVEITDSPYVVFSMRVMTRIGAKVLDILRQDEQFVHCLHAVGSGGTPGWPCDPQNIVVLHKPANNEIVSYGSGYGGNSLLGKKCFALRLGSVIARREGWLAEHMLIVGITNPQGKKRYIAAAFPSACGKTNLAMMTPTLPGYKVECVGDDIAWMKFDKDGVLRAINSENGFFGIAPAATNPIAMATVFKNTVFTNVAETPEGGVWWEGMGPAPERLVDWKGQPWDPSKKTPAAHPNSRFCTPAEQCPMIDGEWESSEGVPISAILLGGRRPAGVPLVVESRDWQHGVFMGASMRSEATAAAEHSGKMVMHDPFAMRPFFGYNFGDYLKHWLSMPQPGRKMPKIFHVNWFRKDEQGKFLWPGFGENSRVLDWILRRCDGEPCHAETPLGYIPRAGALNTENLSAVDMNKLFSIPKDFWLQEADAIEKYFKEEVGEDLPNEMWDELNKLRKNIQGQALN

Summary

EMBL
BABH01032622    BABH01032623    BABH01032624    BABH01032625    DQ443379    ABF51468.1    + More
BABH01032627    DQ443380    ABF51469.1    KQ459460    KPJ00812.1    NWSH01000561    PCG75649.1    JQ730685    AFK28502.1    KZ150212    PZC72166.1    AGBW02012739    OWR44517.1    ODYU01011631    SOQ57498.1    RSAL01000029    RVE51794.1    KC404923    AGC79037.1    KC404939    AGC79053.1    KC404953    AGC79067.1    KC404932    AGC79046.1    KC404941    AGC79055.1    KC404947    AGC79061.1    KC404948    AGC79062.1    KC404952    AGC79066.1    KC404943    AGC79057.1    KC404942    AGC79056.1    KC404933    AGC79047.1    KC404930    AGC79044.1    KC404951    AGC79065.1    KC404936    AGC79050.1    KC404927    AGC79041.1    KC404945    AGC79059.1    KC404931    AGC79045.1    KC404956    AGC79070.1    KC404924    AGC79038.1    KC404946    AGC79060.1    KC404925    AGC79039.1    KC404955    AGC79069.1    KC404958    AGC79072.1    KC404957    AGC79071.1    KC404944    AGC79058.1    KC404926    AGC79040.1    KC404929    AGC79043.1    KC404949    AGC79063.1    KC404928    AGC79042.1    KC404938    AGC79052.1    KC404934    AGC79048.1    KC404935    AGC79049.1    KC404937    AGC79051.1    KC404950    AGC79064.1    KC404940    AGC79054.1    KC409337    AGC79091.1    KC409339    AGC79093.1    KC409325    AGC79079.1    KC409343    AGC79097.1    KC409349    AGC79103.1    KC409335    AGC79089.1    KC409347    AGC79101.1    KC409344    AGC79098.1    KC409348    AGC79102.1    KC409323    AGC79077.1    KC409338    AGC79092.1    KC409334    AGC79088.1    KC409341    AGC79095.1    KC409329    AGC79083.1    KC409332    AGC79086.1    KC409352    AGC79106.1    KC409333    AGC79087.1    KC409326    AGC79080.1    KC409320    AGC79074.1    KC409330    AGC79084.1    KC409345    AGC79099.1    KC409351    AGC79105.1    KC409353    AGC79107.1    KC409342    AGC79096.1    KC409340    AGC79094.1    KC409331    AGC79085.1    KC409328    AGC79082.1    KC409354    AGC79108.1    KC409327    AGC79081.1    KC409322    AGC79076.1    KC409319    AGC79073.1    KC409336    AGC79090.1    KC409321    AGC79075.1    KC409346    AGC79100.1    KC409324    AGC79078.1    KC404954    AGC79068.1    KC409350    AGC79104.1    GFDF01001879    JAV12205.1    KX147668    ARI45072.1    KQ971354    EFA06223.2    KYB26254.1    MH509395    AYU75340.1    FX983740    BAX07239.1    NEVH01021928    PNF19275.1    CCAG010009432    EZ423796    ADD20072.1    CP012524    ALC41177.1    GALX01004273    JAB64193.1    JRES01001421    KNC23063.1    PYGN01000944    PSN39125.1   
Pfam
PF17297   PEPCK_N        + More
PF00821   PEPCK_GTP
Interpro
IPR018091   PEP_carboxykin_GTP_CS        + More
IPR035077   PEP_carboxykinase_GTP_C       
IPR013035   PEP_carboxykinase_C       
IPR008209   PEP_carboxykinase_GTP       
IPR035078   PEP_carboxykinase_GTP_N       
IPR008210   PEP_carboxykinase_N       
SUPFAM
SSF68923   SSF68923       
Gene 3D
PDB
2GMV     E-value=0,     Score=1934

Ontologies

Topology

Length:
719
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01242
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00050
outside
1  -  719
 
 

Population Genetic Test Statistics

Pi
225.518638
Theta
203.099281
Tajima's D
1.171484
CLR
0.292125
CSRT
0.710214489275536
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 ESDVVPSAR 100.00 5e-12
26280517 RVTIEIGGK 95.24 1e-08
27102218 FIWPGFGENSR 95.24 1e-08
28556443 AINPENGFFGVAPGTSAATNPIAMATVFK 100.00 1e-07
26280517 TEVNSGFFYK 100.00 1e-04
28556443 TNLAMMTPTLPGYK 100.00 0.003
28556443 RPAGVPLVVESR 100.00 0.003
28556443 NTIILHKPAENEIVSYGSGYGGNSLLGK 100.00 0.003
26822097 YIAAAFPSACGK 100.00 0.004
26280517 DWIAEKDAAIASDDIGR 100.00 0.004
25044914 DWPYYYEHAFGAK 100.00 0.004
28556443 NTVFTNVAETPEGGVWWEGMGPAPER 100.00 0.004
26822097 FIWPGFGENSR 100.00 0.010
26280517 VDTVPIEPK 100.00 0.010
25044914 VECQNHWFVYNER 100.00 0.010
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号