SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12073
Annotation
PREDICTED:_uncharacterized_protein_LOC101737183_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.659
 

Sequence

CDS
ATGAAGCTCTGTGTTGTGTTCGCGTTCGCTGCTGTAGCCGTGGTGGCGGCTAGTGGTGCAGATGTTAAATCCGGTAGCAGATCTAATCTGAGCGTCGGGTTTATTGGTCCCCAGGACAGGCTGCTGCGTAGCTCGAGATTCTCTCGTATGGCAACCGACCCGTCGTGGCTTCACTTTTATGGTCTCTTTGCACCCCCCGGCACCCGTATTAACGCAGTCCGGGCTACGCAAGTGGGATCACAGTCTCCAACTGTCCAGATTTCCAGGGGCGGCGTAGGCTTCGAGTTTGTGAGTTTTGAGTTCAGAAACGCACCGGGCCGAGGATTCACTTATGACTTGGAAATTTGGGGACGTGATATATCGTTCCATGCTACAACGAGTACTGAAGGAGATAAAATAACCGATGATGTGCGAGCGCCTCGTGTGCCCGCGCCCGCGACCCCCGCTGCCTGCACTGACTCGCTTCGTATCCAGGTAAACAAATCACACATGCAAACACAATGCAATGAATCTGGGTCGGTTCTCGGCCCCCTCTTGTGGAATATCGGGTACGGCTGGGTGCTGAGGGGCGCCCTCCTCCCGGGCCTCCGCGTTATTTGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGATGATTATAGGGAGTCTGCCCGTCTCGCCACAGCGGGAGTGGCCCTCGTCGTCGGAAGGATAAGGAGGCTGGGTCTCGACGTGGCGCTCAATAAATCCGAGGCTCTGTGGTTTCACGGGCTGCGGGGGGCGCCACCCGTTGACACCCACATCGTGGTTGGAGGCGTTCGGATAGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCGTGTTGGACAGCCGGTGGGCTTTTCGTGCTCACTTTGCGGAGCTGGTCCCCCGATTGATGGGGACAGCCGGTTCTTTGAGCCGGCTGCTCCCGAATATTGGGGGACCGGATCAGGTTGTGCGCCGCCTCTACGCGGGGGTGGTGCGATCGATGGCCCTGTACGGTGCACCTGTGTGGGCTGAGCCACGCAACCGGGCCACTATGGCTCGGTTCCTGCGCCGGCCGCAGCGCACCGTTGCCATCAGGTTCATTCGCGGATATCGCACCGTCTCCTTCGAGGCGGCGTGTGTTTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGCGCATCGATGAAGCTCTGTGTTGTGTTCGCGTTCGCTGCTGTAGCCGTGGTGGCGGCTAGTGGTGCAGATGTTAAATCCGGTAGCAGATCTAATCTGAGCGTCGGGTTTATTGGTCCCCAGGACAGGCTGCTGCGTAGCTCGAGATTCTCTCGTATGGCAACCGACCCGTCGTGGCTTCACTTTTATGGTCTCTTTGCACCCCCCGGCACCCGTATTAACGCAGTCCGGGCTACGCAAGTGCGCAACTGTCCAGATTTCCAGGGGCGGCGTAGGCTTCGAGTTTTTAAGATTTTTGCATAA
Protein
MKLCVVFAFAAVAVVAASGADVKSGSRSNLSVGFIGPQDRLLRSSRFSRMATDPSWLHFYGLFAPPGTRINAVRATQVGSQSPTVQISRGGVGFEFVSFEFRNAPGRGFTYDLEIWGRDISFHATTSTEGDKITDDVRAPRVPAPATPAACTDSLRIQVNKSHMQTQCNESGSVLGPLLWNIGYGWVLRGALLPGLRVICYADDTLVVARGDDYRESARLATAGVALVVGRIRRLGLDVALNKSEALWFHGLRGAPPVDTHIVVGGVRIGVGVQLKYLGLVLDSRWAFRAHFAELVPRLMGTAGSLSRLLPNIGGPDQVVRRLYAGVVRSMALYGAPVWAEPRNRATMARFLRRPQRTVAIRFIRGYRTVSFEAACVLAGTPPWELEAESLAADYRWRSASMKLCVVFAFAAVAVVAASGADVKSGSRSNLSVGFIGPQDRLLRSSRFSRMATDPSWLHFYGLFAPPGTRINAVRATQVRNCPDFQGRRRLRVFKIFA

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

SignalP
Position:   1 - 19,         Likelihood:  0.991607
 
 
Length:
498
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
14.44056
Exp number, first 60 AAs:
4.74078999999999
Total prob of N-in:
0.28353
outside
1  -  498
 
 

Population Genetic Test Statistics

Pi
32.967854
Theta
24.403265
Tajima's D
0.604406
CLR
0.89764
CSRT
0.554872256387181
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号