SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12069
Pre Gene Modal
BGIBMGA004292
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.505
 

Sequence

CDS
ATGAAGTTCGCTCTATTGTTCGTATTGACCGCGATCGTCGCGGTGTCGACTAATGAAGTGGCTGACCCCAGATCCACTGACAGAGCTAACGCTTTGAGTATCGGAAGTATTACTTCAAGTGATAGACTCTTACGAAGCTTTGTTGTGAGCCGTGCTGCTACAATTAACTGGCGGGTTCTCAACGTGAGATTCACGGCGCCTGCCGGTAGACGCGTCAGGGCTGTCCGCGTCCGAGGATCGACACAGTTCACAAGGGTCCGCCGCACCGGAGGCGGCGTCGGCTTCACTTTCGTGGAACTCACACACCACAACCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACACCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTGGACATAGCGTTATTAAAAAACGTAACTCTGAGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGACTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACTCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCAACATTAGATAGATCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGATAATATTAGGGAACTCTTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTCTCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGTGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACCGCTTAGCTTGTACTCTCAAATCGGATACGGTAGTAACTATGCCCTCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTTGATGATGACGAAAAAGCAGAGTTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGTCTCCTTGCCCCCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGTGAACTGTAACACCACACCGCGGGAAAGATCCCGCGGTGTGGAAAGAAGCGGACGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGCGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGTGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTTCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTTAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAGAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGTATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGTCAATCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCTTTACAATCCCGCTTTTGCAGATTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATACAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCACTAGACGCCTTCAGCTCTAGGAGCAGGCTTAGGGACCTCGTAAAGTTTGCGGTTTGTGTGCGTCAGATGGAACAATGGGTTATGAAAGGTGGCCCTCAGGAAGCTGATCAGGAAAACAGAAAAACAGAGATGAAGTTCGCTCTATTGTTCGTATTGACCGCGATCGTCGCGGTGTCGACTAATGAAGTGGCTGACCCCAGATCCACTGATAGAGCTAACGCTTTGAGTATCGGAAGTATTACTTCAAGTGATAGACTCTTACGGAGCTTTGTTGTGAGCCGTGCTGCTACAATTAACTCGCGGGTTGTCAACGTGAGGTTCACGGCGCCTGCCGGTAGACGCGTCAGGGCTGTCCGCGTCCGAGGATCGACACAGTTCGCGAGGGTCCGCCGCACCGGAGGCGGCGTCGGCTTCACTTTCGTGAATCTTCAGTTCGTGAACGCGCCGCGAAGAGGATTTCGCTTTACCGTACAAATTTGGGGACGCTAA
Protein
MKFALLFVLTAIVAVSTNEVADPRSTDRANALSIGSITSSDRLLRSFVVSRAATINWRVLNVRFTAPAGRRVRAVRVRGSTQFTRVRRTGGGVGFTFVELTHHNPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLSLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNSDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDNIRELFRAKNASIRAYDRSPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYRLACTLKSDTVVTMPSLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRVSLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMVNCNTTPRERSRGVERSGRKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQAHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSFPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFSQSIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSRSRLRDLVKFAVCVRQMEQWVMKGGPQEADQENRKTEMKFALLFVLTAIVAVSTNEVADPRSTDRANALSIGSITSSDRLLRSFVVSRAATINSRVVNVRFTAPAGRRVRAVRVRGSTQFARVRRTGGGVGFTFVNLQFVNAPRRGFRFTVQIWGR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    KQ973342    KXZ75569.1    GGMS01006359    MBY75562.1    GBBI01004395    JAC14317.1    ABLF02042518    ABLF02057746    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GFTR01008262    JAW08164.1    GGMR01018716    MBY31335.1    GFTR01008038    JAW08388.1    ABLF02034467    NEVH01006736    PNF36716.1    GEZM01053022    JAV74219.1    LBMM01013518    KMQ85605.1    GGMS01000737    MBY69940.1    GFTR01008251    JAW08175.1    NEVH01022639    PNF18527.1    AY060438    AAL25477.1    GFTR01008246    JAW08180.1    GGMR01003407    MBY16026.1    GFXV01000908    MBW12713.1    ABLF02041767    GFTR01008261    JAW08165.1    GBBI01004571    JAC14141.1    NEVH01021205    PNF19912.1    GFTR01008271    JAW08155.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    S59870    AAB26437.2    NEVH01014858    PNF27387.1    GFTR01008151    JAW08275.1    GEZM01084969    JAV60363.1    NEVH01007838    PNF34986.1    NEVH01002716    PNF41415.1    ABLF02037436    GECL01003538    JAP02586.1    NEVH01019964    PNF22161.1    GGMS01017365    MBY86568.1    NEVH01006754    PNF36554.1    NWSH01007753    PCG62823.1    NEVH01020940    PNF20481.1    ABLF02023911    ABLF02014118    ABLF02014121    ABLF02054790    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    AF237761    AAF81411.1    GGMR01014053    MBY26672.1    NEVH01006721    PNF37225.1    GGMR01000226    MBY12845.1    NEVH01017470    PNF24199.1    GGFJ01001858    MBW50999.1    NWSH01000032    PCG80496.1    GGFJ01001857    MBW50998.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGMR01016905    MBY29524.1    GBGD01000415    JAC88474.1    KU543673    AMS38352.1    KK119692    KFM76444.1    GEDC01000337    JAS36961.1    KU543685    AMS38375.1    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

SignalP
Position:   1 - 17,         Likelihood:  0.994537
 
 
Length:
1016
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.40069
Exp number, first 60 AAs:
0.06195
Total prob of N-in:
0.00343
outside
1  -  1016
 
 

Population Genetic Test Statistics

Pi
19.34702
Theta
195.457492
Tajima's D
-1.772264
CLR
1087.934635
CSRT
0.031698415079246
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号