SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12068
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.685
 

Sequence

CDS
ATGGATTTCGAATCCGCGTCAAGCCCTCAGCCTGGAACTTCGGATGGGTTCCAAACCGTAACGCGCGGTAAAAAGCGTACTCGCGCCGTGGAGTCCCGGAACTCCACGACAAAACAGACGAAATCCGCGTCCGCCTCTCGACCGAAAGTAGTAGTTACACCGGAGTCGGACTCCGCGCGCCGCGTAACCCCACCGCCGCGTCCCAAGCCCGCGCCCGCTCCCAAAGTAGCTGCCCCGCCCCCGCTGATACTTCAAGAGAAGACAGCGTGGAATCGCGTGTCCCAGGCCCTTCAGGCAAATAAAATTAACTACACCCATGCGCGTAACGTCGCGCATGGGATTCAGATCAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCAGCATACCTCCGAAAGGAGAACATAGGTTTCCACACCTATGCTCTTCAGGAGGACCGCGAGCTCCGCGTAGTAATACGCGGAGTCCCTAAGGAGCTAGAAATAGACTACATTAAGGAGGATCTGACCGCTCAGGCCCTCCCGATAGTTAGTGTGCACCGGATGCACAGCGGGCGGGGCAAACAGCCCTATAATATGATACTCGTGGCGTTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCGATCGAAGCCCCCCACAAGCGTGGCACTCCCGGGCAGTGCTACAGGTGCCAACTCTATGGCCACTCGGCGCGTAATTGCCACGCGCGCCCCCGCTGCGTGAAATGCCTCGGCGATCACGCTACGTTAGACTGCATTAGAGATAGGGAAACCGCGACCGAACCTCCCAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCCAGGGCTCCGCGAAAACGCCCAACCCACCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCTTCAGTGCCGAAACCCGCCTTCGTGCCGGCTGCAGTTCCCACGGTCTCGGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACGGAAACCGCACCCCCGCCCCCGCTCGTGACACGCCCCGCGCCCCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCCGCCGTCAACGACTTCGCGCTCGTGCGTGACTTCGTCACCGCGGTCAACTTCGACCGTCTGCGATCGTTCGCAGACGCGATACGTAGGTCGGTAACCCCCGAACAGCGGCTCGCGGCCGCTTTCGATCACATGGACGTCTACGAGTCCGTGTCGCCATTCTATAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTTGAATTCCTCCGCGACAATCTTGTAGATATTCTATTAGTGCAGGAAACCTGTCTGAAGCCCTCGCGTCGTGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCTGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCTAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCAGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCTTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGACTGAGCTGCTGGCCGATGCACTGCAAGACACTCAACACGCGGACCCCGAACACACCGAGTTGGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACGGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCAGGCTCCGACGGCATCCACAACCGCGCGCTAAAATTTTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGAGAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGTCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTATAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACCGCCGGAGTCCCGCAACGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATACCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCGCAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTTATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAGCCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCTTGGTTCCTTAGGAATGTGGATCTCCACGACGACCTGGAGCTCGACTCTTTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGTTTCTCCCGTACGATTTCCCTCCATTTGCTGCGATTCTTAGTTTCATGAAGGGCATCGTGGAAGCTGATGTTCAGAGAAGATCACATTTGGTCCGACCATCTCGTGGAACAGCGTCCTCTGGAACGTTACCCATCTAA
Protein
MDFESASSPQPGTSDGFQTVTRGKKRTRAVESRNSTTKQTKSASASRPKVVVTPESDSARRVTPPPRPKPAPAPKVAAPPPLILQEKTAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGFHTYALQEDRELRVVIRGVPKELEIDYIKEDLTAQALPIVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATLDCIRDRETATEPPSCVLCLKQGHPANYRGCPRAPRKRPTHPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTETAPPPPLVTRPAPQPLLAPRPAPAFRPPQPSAVNDFALVRDFVTAVNFDRLRSFADAIRRSVTPEQRLAAAFDHMDVYESVSPFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADAAPPILPYGPDSNPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIQMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLLRPSGQPPAFDDDDKTELLADALQDTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKFLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPRNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQRSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSFSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMFLPYDFPPFAAILSFMKGIVEADVQRRSHLVRPSRGTASSGTLPI

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.0110009,     Score=96

Ontologies

Topology

Length:
1369
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.21852
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1369
 
 

Population Genetic Test Statistics

Pi
0.608265
Theta
0.876226
Tajima's D
-1.855618
CLR
5045.949513
CSRT
0
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号