SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12055
Pre Gene Modal
BGIBMGA004304
Annotation
PREDICTED:_uncharacterized_protein_LOC105841508_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.926
 

Sequence

CDS
ATGGAAAAACAACCTGACGTACCAGAAGATTTCACAAATGAGCCACTACCTTCGATGAATGTACCCATGGAGGTTGAAGATGCTGTAGCATCTACTTTAGCAACGCCATTCGCGCAGCCAATAATCTTTGCTTCAAAATCGAAAGCACAAAAACAACGTGAGTACAGACAGCGTATCGCAGCATCTAGAACTCCTGAAGAGGCGGCTGCTGCAAGAAAATTAAAAAACGAAAGACAACGCAAAAACAGATTACGCCAAGCTGCTAACTTGGCTCGATCTACCTCTGCGACGCCATTTGCAGAACCAATAACTGCTGCTCCAAAAACAAGGGCACAAATACAACGTGAGTACAGACAGCGGACTGCTGCATCCAGAACTCCTGCACAGGCAGCAGCTGCAAGAGAAGCACGTAATATAAGAGAGCGAAACAACAGATTATACCAAGCTGCTAACTTTGCTATTGCCAGTGGTTCTCTGGAAGCGACAACTACTTTTTTCTTAAATAATATTAACAGGTGGTACCACATGAAAACTTTAGTACTGGACAAGCTGAAGACACTTTATGCGGCAGATGATAAAAGTGAAAATGTATCTGCTAAGGACCGAATGTCCCAGATGGATTGGTTTATATTTGACTTTGCTCTCGTCCATGAGAAAATAGATCTAATTGGAAAAGATGGTATGAGATGTCAAACTCAGGATCGTCAGCCGTTGATTGATCTCTTCGAGCTGGTGACGAAGTTTGACATAGAGGACAGGTCCGGAGACAGTCTGGCCGGCGCCTGGAGTGCGGCCACCGCCCTCTACAACTCGAGGGGTCGTCAGTGCTCACCGATGCTACTGCAGAAGCGTTGGTATCAGCTGAAGGAGATGACCAGGGAATCGCTATATGAGTACTGGTACGCCTCCCGCGAGAACTATCCTTCGTCGGCCGAGTCTATACAAAGACCAACCAAATTACAGAGAGCTGTGGCCCAGAAAAAAGGCTTTGTGTTTTTTAAAAAGGCCGACGCCAGCCGCCTGTGGCCTAACAGCACCACCTTCGGGCCCGGCAGGCTTTTCCTACGGATAGGGAGCGTGCTTGTGCGAGAGGAGTTGGCTGATATGCGTGCGACCTTCGACGGTGTTGTTGGACGTCAGAGCAATTTGATCTCCGCCATCCCCGAGCTGACGAGACAACTCGGGACCCGGGGGGACTGCGCCTCCAAGGTTAAGCGCGCGAGACCATTGCTGGTGCATGAGCGCCCCGTGCCCGTACCATCGTCACGCGGAACGGTGCCGTCCTCAAAAGCCGCAGCGGCTGAAGAAAAGGAGAATTGGATGAACCACGCGGAAGCTTCTATAGACACTGGCAAGTTTATTGATTTTCTTACAATTCAATGTTTACGTAATAACAGTAACTATAGTGACGACGAGAGAGGGAGAGAGAGAGAGAGAGCAGTAAAAACCACAAAATAATCTCAACCAGACTTAGTAGTCATTGAACCTTTCATAGAAACGATAGACGTGGACCAAGATTTGGACAACGAAACAAGGGAGCACGGGAGAAGAAGCGAAGAGAACACTGAAACCAATAGAATGATTATTGAAATAAAATCCGAACCTAGAGATTTTGAAGATCTGGCTGACCCATTGCAAACTATCAAAACACCATTACTTTTATACACTGGGAAAACAGAACAATTGATCGAAAATGAAACATGCAATACTGATTCTGGTGAAGATGTGGTGAAGACTGACAAAAATATAAACATTACCCCTACTCTTGATTACCTTCGCGAAACAATCGAAAATTCAAATGAAGCGAAAACTAAACTAATTGAGGAAATAGTACCGAAAATTGCCGGTGTCTACGGCAACGTGCATGATTGTCAAGAAATTAAAGATCCACGAGCTACAAAAGTATGTGAAGATAAACCAATGATTGTAGAAGAAACTAAATGTTACCGAGTTGCAACCAACAATGTGTCTAATGCAGAAGATATACAAGAAAAAGTCTTGCAAGAGACAAATATAATATTAAAGTCTGAAATGGAAGAACAATTGCAATTAAATATTTTTGATAACGTAATAGAATTTGCTGATAACAATGTCCAGTCTATTGAAAATGAACATGTAAATACAGCTCACGTTATTCAGACCAAAAACGATTTCACTTTACAAAGTCAGTTAAGTTATAAAAATGGAAATAGTACACCAACTTTTGAATCGAAACGTTTCAAGCGTCTCTTTGATCTGAAAGAAGATGAAATTAAATTGTCAAAAAACAATCCGCACGCTTGTAACGAAAAATACAGTTTAAAACAACTGAACATTTCGGAAATACAAACTGATGTTGATAAAATTACGAATCGAAATAATTCTGACATCAGTAATACAATGAACAACACTTTGTTCTTAGAAAGTACAACTGGTGCACAAAGCGAAAATAGAACAGACGATAGTATGAAAGTGAAAATGTCTAGTCACTTATTTCATAAACCCCGAAATCGTTCGTATGATCCTACACAGCTTTGCAAGAATCCGGACTTTAACAAGAAGTTGAAAAGATTAACGGATGCATTCTTAAGTTCGCCGCGTAACAGGGTACTGCTCAATGCTTGCAGGCCGATCACTGTTGATGTAATGAAGGCGATTGAATCCAAACTGTTCAACGGTACAGTGTACTTGAAGGACTGCGACCAACTGAACTCGAATGTTCCAGACCGCGGCGCCGTTAGCGACACTGCGACGCGAGTTCCTTCAACAATCGCTTCCCGGAGCTCAGCAAATATTCGTTTAGTCAATCCTGATCATTTAATGCCGCTATCGAAATGTTACACTCCGAATTTAACACAAAATTGCGGTGATGCGATGGAGATAAACAGGAAGATCAATCAACCAAGTAAAACAGAAGTTCCTTGCTCAAATCAAAGTTGGCTGACAATTGAAGTACCTCCCCTTACCATGCAAACTAATAATGAAAGTATAGCTGCAACTCCAGAACTCAAGTCAAACCTATCGTGTACAGTGAAAGAAACCGGTATTTCGTCCAAAAAGAAACCAAGACAAGAACTTTCCGTTGTGAACGATTGTATTCTTACCCACGACATCCTCAACAATATGTTAGTAAAAATGGATGAAGATGAACATAATTCTTCCAGAGTCACTTTTGGTATATCATCTCAGATACTAAAGCCAAACACAAAAAATACCATGCTTATGAAAAACAAAAGTATTCCCAATGTTGAAATACAACCTTGCAGATCTCCTGCACAAAATACAACAAAAATGGTGTCAGCTGTCGAACTATTGAGTGAGCGAAATTATTCCGCGGCGAATGACAGCCCTATCATGGCAGACAACATTGTGATCGACAGTGAAAGTCAAATCGTTAAACCGGTATTCGCGCAGGAATTATACCAGACCGACAAACATGAAATTATAAATAAGACATCTAACGTAAAAACTCTAGTGATAGAGCCAATCTTCAACCATGTTGCCGAACAGTCTAAACAACTTATGTTTATGGTGTCACTTGCGTCTCAACAAATATTAGATAAACGGAAAGAAATAGATTAA
Protein
MEKQPDVPEDFTNEPLPSMNVPMEVEDAVASTLATPFAQPIIFASKSKAQKQREYRQRIAASRTPEEAAAARKLKNERQRKNRLRQAANLARSTSATPFAEPITAAPKTRAQIQREYRQRTAASRTPAQAAAAREARNIRERNNRLYQAANFAIASGSLEATTTFFLNNINRWYHMKTLVLDKLKTLYAADDKSENVSAKDRMSQMDWFIFDFALVHEKIDLIGKDGMRCQTQDRQPLIDLFELVTKFDIEDRSGDSLAGAWSAATALYNSRGRQCSPMLLQKRWYQLKEMTRESLYEYWYASRENYPSSAESIQRPTKLQRAVAQKKGFVFFKKADASRLWPNSTTFGPGRLFLRIGSVLVREELADMRATFDGVVGRQSNLISAIPELTRQLGTRGDCASKVKRARPLLVHERPVPVPSSRGTVPSSKAAAAEEKENWMNHAEASIDTGKFIDFLTIQCLRNNSNYSDDERGRERERAVKTTKXSQPDLVVIEPFIETIDVDQDLDNETREHGRRSEENTETNRMIIEIKSEPRDFEDLADPLQTIKTPLLLYTGKTEQLIENETCNTDSGEDVVKTDKNINITPTLDYLRETIENSNEAKTKLIEEIVPKIAGVYGNVHDCQEIKDPRATKVCEDKPMIVEETKCYRVATNNVSNAEDIQEKVLQETNIILKSEMEEQLQLNIFDNVIEFADNNVQSIENEHVNTAHVIQTKNDFTLQSQLSYKNGNSTPTFESKRFKRLFDLKEDEIKLSKNNPHACNEKYSLKQLNISEIQTDVDKITNRNNSDISNTMNNTLFLESTTGAQSENRTDDSMKVKMSSHLFHKPRNRSYDPTQLCKNPDFNKKLKRLTDAFLSSPRNRVLLNACRPITVDVMKAIESKLFNGTVYLKDCDQLNSNVPDRGAVSDTATRVPSTIASRSSANIRLVNPDHLMPLSKCYTPNLTQNCGDAMEINRKINQPSKTEVPCSNQSWLTIEVPPLTMQTNNESIAATPELKSNLSCTVKETGISSKKKPRQELSVVNDCILTHDILNNMLVKMDEDEHNSSRVTFGISSQILKPNTKNTMLMKNKSIPNVEIQPCRSPAQNTTKMVSAVELLSERNYSAANDSPIMADNIVIDSESQIVKPVFAQELYQTDKHEIINKTSNVKTLVIEPIFNHVAEQSKQLMFMVSLASQQILDKRKEID

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
1186
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.52137
Exp number, first 60 AAs:
0.07571
Total prob of N-in:
0.01692
outside
1  -  1186
 
 

Population Genetic Test Statistics

Pi
223.500135
Theta
190.560664
Tajima's D
0.320499
CLR
0.079563
CSRT
0.452327383630818
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号