SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12054
Pre Gene Modal
BGIBMGA004306
Annotation
PREDICTED:_uncharacterized_protein_LOC101743591_isoform_X2_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.337
 

Sequence

CDS
ATGACATCAAGTAAAGAACTCTGGGCATATATGAAGACTCATTTTGAAAGTAACAGATTGCCGTGGTACCACATGAAAACTTTAGTACTGAACAAGCTGAAGAGACTTTATGCGGCAGATGATAAGAGTGAAAATGTATCGGCTAAGGACCGAATGTCCCAGATGGATTGGATTATATTTGACTTTGCTCTCGTCCATGAGAAAATAGATCTAATTGAAGTGAATGGTATGAGACGTCAAACTGAGGATCGTCAGCCGTTGATTGATGTCTTCGAGCTGGTGACGAAGTTTGACATAGAGGACAGGTCCGGAGACAGTCTGGCCAGCGCCTGGAGTGCGGCCACCGCCCTCTACAACTCGAGAGGTCATCAGTGCTCACCGATGCTACTGCAGAAGCGTTGGTATCAGCTGAAGGAGGTGACCAGGGAATCGCTATACGAGTACTGGTACGCCTCCCGCGAGAACTCTCCTTCGTCGGCCGAGTCTATACAAAGACCAACCAAATTACAGAGAGCTGTGGCCCAGAAATACCCGTCAATAATAACGAGCGCGTTTCCGGAATGGCGAGAACAGATCGAGAACAGACTTGTAATAATGTCAGAAGACTTCGAAAAGGAGAATTGGATGAACAACACGGAAGCTTCTATAGACACTGAATCTAAACCAGACTTAGAAGTCATTGAACCTTTCATAGAAACAATAGATATGGATCACGTACAAAAACCGAGACAAATTACTGTTGATGTTGGGTCGAACAAAGAGCCAAGACATTCTGCAGAACGTGGTCGAGAATTCAGCTCACGAAAAGCACTGATTAAACAACAAAGTCATCACCAACAGGAACCAGATGCTATAGCTGAAATTGGTGTAGAAGATATTCAAAGTGCCAGTCCATCAGAAGACAATCAAGTCTCTGAACCCTCTGAAATGAGGACAATAGAAAAAAGAGCAAATAATAAAACGTCTGGAAGTAATGAAGAACAGTCAGAACTCAGTGATTCAACTTTGACTTTGAAATATGACATTACAAAACACCAAATGGCTCATGAAAATTTTGATCGAAATTTCCAGAAAAATCCCTTTGTTTATTCATGTACAGACCTTAAAAAGGCATCTGCCATTTATGAAGATCAGTTGAAGAAAATAACGTTCGTCATGTCCAAATCGTCGACGAGTCGATCTGAAGAAGATCGACTTCGGAAAACTATAGCGGCAGAGAAAAGGGCAGAGCGAAATCGACGGTACAGAGCGCGGCAGAGAGCTCTGCGGTATGCGGCAACTCAGCAAATTGCATGCGCGCACATTGCAACAGGGAGTAGAGATCGCGTCCATGAACAAACTTCGATGAATGATAGAGTTGATGAGCGTGAACAAAAGAAGATATCCAGGAAAAAGCCAGCGCTGACGGGAGCGGAACGTGCTAGAAGATTCAGGGCTTCACGAAGGGCTCGAAAAAATGCGTCTAAGTTAGCCGACAGTAATCAGCCGATGATTGTCGATGAGGAAAAGAAGAAATGGACAAACAACGCAGAAGCTTCTATAAACACTGAATCTAAACCAGATTTAGAAGTCATTGAACCTTTCATAGAAACGATAGATGTGGACCAAGATTTTGACAACGAAACAAGGAAGCTCGGGAGAAGAAGCGAACAGAACACTGAAACCAATGGAATGATTATTGAAATAAAATCCGAACCTAAAGATTTTGAAGATCTGGCTGAGCCATTACAAACTATCAAAATACCATTACTTTTACACACCGGGAAAACAGAACAATTGATCGAAAATGAAACATGCAATACTGATTTTGGTGAAGATATGATAAAGACTGAAAAAAATACAAATATTATCCCTACTCTTGATTACCTTCGCGAAATTACAAAAAAATCAAGTGAAATGAAAGCCATATTTATTGAGGAAATAGTACCGAAAATTGCCGGTGTTTACGGCAACGTGAATGATACTTATGATAGTAAAGATCCACGAGCTACAAAAGTATGTGAAGATGAAGCAATGCTTGAAGAAGCAACTAAATGTCACCGAGATGCAATCAACGATGCGTCTAATGCAGTCAATACACAAGAAAGAATCTTGCAAGACACAAATACAATATTAAAGTCTGAAATGGAAGAACAATTGCATTTGAATATTTTTGATAACGTGATAGAATTTGCCGATAACAATGTCCAATATATTGAAAATGATCATGTAAATACAGTGCACGTTATTCAGACCAAAAACGATTTCACTTTACAAAGTCGGTTAAGTTGTGAACATGGAAATAGTACATCGACTTCTGAATTAAAATGTCTCTTTGATTTGAAAGAAGATGCAATGAAAATGTCAAAAAACAAGCCGCAGGGTCGTAACTTAAAAGACAGTTTAAAACAACTGAACATTACGGAAATACAAACTGATGTTAATAAGACTACGAATCGAATTAATTCTGACATCAGTAATACAATGAACAACACTTTGTTCTTAGAAAGTAAATCTGGTGCACAAAGCGAAACTAGAACCGACGATAGTATGAAAGTGAAAATGTCTAGTTACTTATTTCATAAACCCCGAAATCGTTCGTATGATCCTACACAGCTTTGCAAGAATCCGGACTTTAACAAGAAGTTGAAAAGATTAACGGATGCATTCTTAAGTTCGCCGCGTAACAGGGTACTGCTCAATGCTTGCAGGCCGATCACTGTTGATGTAATGAAGGCGATTGAATCCAAACTGTTCAACGGTACAGTGTACTTGAAGGACTGCGACCAACTGAACTCGAATGTTCCAGACCGCGGCGCCGTTAGCGACACTGCGACGCGAGTTCCTTCAACAATCGCTTCCCGGAGCTCTACAAATATTCGTTTAGTCAATCCTGATCATTTAATGTCGCTATCGAAATGTTACACTACGAATTTAACACAAGAAAGTTGTGGTGAAGCGATGGAGATAAACAGGAAGATCAATCAACCAGATATAACAGAAGTTCCTTGCTCAAATCAATGTTGGCTGACAATTGAAGTACCTTCCCTGACCGTGCGAAATAATAATGAAAGTATAGCTGCAACTCCAGAACTCAAGTCAACCCTTTCGTATACAGAAAAAGAAACCGGTATTTCGTCCAAAAAGAAACCAAGAAAAGAACTTTCAGTTGTGAATAATTGTATTCTTACCCACGATATCCTCAACAAAATGTTAGTAAAAATGGATGAAGATGAACATAATTCTTCCAGAGTAACTTTTGGTATATCGTCTCGGAGACTGAAGCCAAACACAAATAAAACCATGCTTAAGAAAAACAAAAGTATTCCCAATGTTGAAATACAAACCTGTAGGTCTCCTGCACAAAATACAACAAAAATTGTGTCAGCTGTCGAACTACTGAGTGAGCGAAATTATTCCCCGGCGAATGACAGCCCTATCATGGCAGACAACATCGTAGTCGACAGTGAAAGTCAAATCGTTAAACCGGTATTCGCGCAGGAACAATACCAGACCGACAAACATGAAATGATAAATACGACATCTAACGTAAAGACTCTAGTGATAGAGCCAATCTTCAATCATGTTACCAAACAATCTAAAAAACTAATGTTTTTGGCGTCGCTTGCGTCTCAACAAACGTTAGATAAACGGAAAGAAATAGATGAAACTTCTTACGTTAATGTAGATAATAACTACGACGACATCACTGGAAAGATCGTAAAAGTTGACGGAAATTTCAATTTAAATAAAAGTATCAATAATGCAAGCCCTTCCCACATGGCTGTGGGAATGTGA
Protein
MTSSKELWAYMKTHFESNRLPWYHMKTLVLNKLKRLYAADDKSENVSAKDRMSQMDWIIFDFALVHEKIDLIEVNGMRRQTEDRQPLIDVFELVTKFDIEDRSGDSLASAWSAATALYNSRGHQCSPMLLQKRWYQLKEVTRESLYEYWYASRENSPSSAESIQRPTKLQRAVAQKYPSIITSAFPEWREQIENRLVIMSEDFEKENWMNNTEASIDTESKPDLEVIEPFIETIDMDHVQKPRQITVDVGSNKEPRHSAERGREFSSRKALIKQQSHHQQEPDAIAEIGVEDIQSASPSEDNQVSEPSEMRTIEKRANNKTSGSNEEQSELSDSTLTLKYDITKHQMAHENFDRNFQKNPFVYSCTDLKKASAIYEDQLKKITFVMSKSSTSRSEEDRLRKTIAAEKRAERNRRYRARQRALRYAATQQIACAHIATGSRDRVHEQTSMNDRVDEREQKKISRKKPALTGAERARRFRASRRARKNASKLADSNQPMIVDEEKKKWTNNAEASINTESKPDLEVIEPFIETIDVDQDFDNETRKLGRRSEQNTETNGMIIEIKSEPKDFEDLAEPLQTIKIPLLLHTGKTEQLIENETCNTDFGEDMIKTEKNTNIIPTLDYLREITKKSSEMKAIFIEEIVPKIAGVYGNVNDTYDSKDPRATKVCEDEAMLEEATKCHRDAINDASNAVNTQERILQDTNTILKSEMEEQLHLNIFDNVIEFADNNVQYIENDHVNTVHVIQTKNDFTLQSRLSCEHGNSTSTSELKCLFDLKEDAMKMSKNKPQGRNLKDSLKQLNITEIQTDVNKTTNRINSDISNTMNNTLFLESKSGAQSETRTDDSMKVKMSSYLFHKPRNRSYDPTQLCKNPDFNKKLKRLTDAFLSSPRNRVLLNACRPITVDVMKAIESKLFNGTVYLKDCDQLNSNVPDRGAVSDTATRVPSTIASRSSTNIRLVNPDHLMSLSKCYTTNLTQESCGEAMEINRKINQPDITEVPCSNQCWLTIEVPSLTVRNNNESIAATPELKSTLSYTEKETGISSKKKPRKELSVVNNCILTHDILNKMLVKMDEDEHNSSRVTFGISSRRLKPNTNKTMLKKNKSIPNVEIQTCRSPAQNTTKIVSAVELLSERNYSPANDSPIMADNIVVDSESQIVKPVFAQEQYQTDKHEMINTTSNVKTLVIEPIFNHVTKQSKKLMFLASLASQQTLDKRKEIDETSYVNVDNNYDDITGKIVKVDGNFNLNKSINNASPSHMAVGM

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
1258
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00111
Exp number, first 60 AAs:
0.00029
Total prob of N-in:
0.00006
outside
1  -  1258
 
 

Population Genetic Test Statistics

Pi
237.494186
Theta
166.818182
Tajima's D
1.133141
CLR
0.347186
CSRT
0.687815609219539
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号