SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12053
Pre Gene Modal
BGIBMGA004325
Annotation
PREDICTED:_uncharacterized_protein_LOC101743310_isoform_X5_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.022
 

Sequence

CDS
ATGCATGCGTGTGTGCGTCAAATACACGATATCTCGAACAACCTTGCATTGGAAAGCTCTGAACATCAAAAGAATCCTATATTGGTTTCGGAGAACCAACTAATAGACGAAATGGAATCAAATAAAGAACTCTGGACAAATATGAAGATGCATTTTGAAACTAACAGATTGCCATGGTACCACATGAAAACTTTAGTACTGAACAAGCTGAAGAGACTTTATGCAGCAGATGATAAGAGTGAAAATGTAACGGCTAAGGACCGAATGTCCCACATGGAATGGATTATATTTGACTTTGCTCTCGTCCATGAGAAAATAGATTTAATTGAAAACGATGGTATGAAATGTCAAACTCAGGATCGTCAGCCGTTGATTGATCTTTTCGAGCTGGTGACGAAGTTTGACATAGAGGACAGGTCCGGAGACAGTCTGGCCGGCGCCTGGACTGCGGCCACCGCCCTCTACAACTCGAGAGGTCATCAGTGCTCACCAATGCTACTGCAGAAGCGTTGGTATCAGCTGAAGGAGGTGACCAGGGAATCGCTATATGAGTACTGGTACGCCTACTGCGAGAACTCTCCTATACCGGCCGAGTCTATAAAAAGACCAACCAAATTACAGAGAGCTGTGGCCCAGAACATTGCCGATGCTCCCCAGCAGCAGTGGCTGTTCGAGATGATAGCGGTTCGTTTATCTCAACATAAAGAGCGAATCATTGGAATGTTCTATTCCAGATACCCGTCAATAATAACCAGTGCGTTTCCGGAATGGCGGGAACTGATCGTGAAAAGACTTGTAATAATGTCTGAAGACTTCGAAAAGGAGAATTGGATGAACAACGCGGAAGCTTCTATAGACACTGGCAAGTTTATTGATTTTCTTACACTTCAATGTTTACGTAATAACAGTAACTATAGTGACGACGAGAGAGGGAGAGTAGTAAAAACCACAAAATGTAATTTACAGTACGGGATCCGGTTACAAGATTCTAGAACATTCAAGCTGATAATTAAAATTAAAATTTTGCACAATGTATTTATGAATAGAGGAGAATCTCAACCAGACTTAGAAGTCATTGAACCTTTCATAGAAACGATAGATGTGGACCAAGATTTGGTCAACGAAACAAGGAAGTACAGGAGAAGAATCGAAGAGAGCAGTGAAACCAATGGAAAGGTTATTGAAATAAAATCCGAACCTACAGATTTTGAAGATCTGATTGACTCATTACAAAATACCAAAATACCATTACACACACTGTATTTACACACTGGCAAAACAGAAAAAATGATCGAAAATGAAACATGCAATAATGTTTCTGGTGAAGATGTGGTAAAGACTGAAAAAAATAAAGATATTTCCCCTAATCTTGATTACCTTCGCGAAACAATCGAAAATTCAAATGAAGCGAAAACTACACTAATTGAGGAAATAGTACCGAAAATTGCTGGCGTCTACGGCAACGTGCATGATTGTCAAGAAAGTAAAGATCCACGAGCTACAAAAGTATGTGAAGATGAAGCAATGCTTGAAGGTGCAACTAAATGTTACCGAGATGCAATCAACGATGTGTCTAAGGCAGTAGATACACAAGAAAGAATCTTGCAAGACACAAATATAATATTAAAGTCTGAACTGGAAGAACAATTGCATTTGAATATTTTTGATAATGTGATAGAATTTGCTGATAACAAAGTCCAGTCTATTGAAAATGATCATGTAAATACAGCTAACGTTATTCAGACCAAAAACGATTTAACTTTACAAAGTCGGTTAAGTTGTGAACATGGAAATAGTACATCCACTTCTGAATTAAAATATCTTGATTTGAAAGAAGATGCAATGAAAATGTCAAAAAACAAGCCGCACGGTTGTAACTTAAATGACTGTTCAAAACAACTGACAATTTGGGAAATACAAACTGATGGTAGTAAAATTACGAATCCAAATAATTCTGGCATCAGTAATACAGTGAACAACACTTTGTTCTTAGAAAGTAAATCTGGTGCACAAAGCGAAACTAGAACAGACGATAGTATGAAAGTGAAAATGTGTAGTTACTTATTTCATAAACCCCGAAATCGTTCGTATGATCCTACACAGCTTTGCAAGAATCCGGACTTTAACAAGAAGTTGAAAAGATTAACGAATGCATTCTTAAGTTCGCCGCGTAACAGGGTACTGCTCAATGCTTGCAGGCCGATCACTGTTGATGTAATGAAGGCGATTGAATCCAAACTGTTCAACGGTACAGTGTACTTGAAGGACTGCGACCAACTGAACTCGAATGTTCCAGACCGCGGCGCCGTTAGCGACACTGCGACGCGAGTTCCTTCAACAATCGCTTCCCGGAGCTCTACAAATATTCGTTTAGTCAATCCTAATCATTTAATGTCGCTATCGAAATGTTACACATCGAATTTAACACAAGAAAGTTGTGGTGATGCGATGGAGATAAACAGGAAGATCAATCAACCAGATATAACAGAAGTTCCTTGCTCAAATCAATGTTGGCTGACAATTGAAGTACCTTCTCTGACCGTGCGAACTAATAATGAAAGTATAACTGCAACTCCAGAACTCAATTCAAACCTATCGTGTACAGAAAAAGGAACTGGTATTTCGTCCAAAAAGAAACCAAGAAAAGAACTTTCAGTTGTGAATGATTGTATTCTTACCCACGACATCCTCAACAAAATGTTAGTAAAAATGGATGAAGAAGAACATTTTTATAATCCTTCCAGAGTAACTTTAGGTGCGTCGTCTCGGATACTGAAGCCAAGCACAAACACAAGTAATCCCAGTGATGAAATCAAAATCTGTCCCTGTAGGTCTCCTGCACAAAATACAACAAAAATTGTGTCAGCTGTCGAACTGTTGAGTGAGCGAAATTATTCCGCTGCTAGTGACAGCCCTATCGTTACAGAAAAAATCTTGGTTGACTGCGAATGTAAAATCGTTGAACCAGTACTCGCGCAGGAACAATACCAGACTGACCAACATGAAATGATATTTATGACATCTAACGTAAAGACTCTAGTGATAGAGCCAATCTTCAACCATGCTGCCGAACAATCTAAACAACTTATTTTTTTGGCGTCGCTTGCGTCTCAACAAACGTTAGATAAACGGAAAGAAATAGATAAATCTCCTGATTTTATCATTGAAAACAACTACGACATCACCGAAAATATCGTAAAAGTTGACGCTATTTCCAAGCCTAATAAAAATATCCTGAACAACCTTGCATTGGAAAGCTCTGAACATCAAAAGAATCATATATTGGTTTCGGAGAACCAACTGATAGATGAAATGAAATCAAATAAAGAACTCTGGACAAATATGAAGATGCATTTTGAAACTAACAGATTGCCATGGTACCACATGAAAACTGTAATACTAGACAAGCTGAAGACACTTTATGCGGCAGATGATAAAAGTGAAAATGTATCTGCTAAGGACCGAATGTCCCAGATGGATTGGATTATATTTGACTTTGCTCTCGTCCATGAGAAAATAGATCTAATTGGAAAAGATGTTATGAGATGTCAAACTCAGGACCGTCAGCCGTTGATTGATCTCTTCGAGCTGGTGACGAAGTTTGACATAGAGGACAGGTCCGGAGACAGTCTGGCCGGCGCCTGGACTGCGGCCACCGCCCTCTACAACTCGAGGGGTCGTCAGTGCTCACCGATGCTACTGCAGAAGCGTTGGTATCAGCTGAAGGAGGTGACCAGGGAATCGCTATATGAGTACTGGTACGCCTCCCGCGAGAACTCTCCTATACCGGCCGAGTCTATAAAAAGACCAACCAAATTACAGAGAGCTGTGGCCCAGAAATACCCGTCAATAATAACCAGTGCGTTTCCGGAATGGCGGGAACTGATCGAGAAAAGACTTGTAATAATGTCTGAAGACTTCGAAAAGGAGAATTGGATGAACAACGCGGAAGCTTCTATAGACACTGAATCTAAACCAGATTTACAAGTCATTGAACCTTTCATAGAAATGATAGATGTGGACCAAGACTTGGACAGCGAAACAAGGGAGCACGGGAGAAGAAGCGAAGAGAACACTGAAACCAATGGAATGATTATTGAAATAAAATCCGAACCTAGAGATTTTGAAGATCTGGCTGAGCCATTACACACTATCAAAACACCATTACTTTTATACACTGGGAAAACAGAACAATTAACCGAAAATGAAACATGCAATACTGATTCTGGTGAAGATGTGGTGAAGACTGACAAAAATATAAACATTACCCCTACTCTTGATTACCTTCGCGAGACAATCGAAATAGTACCGAAAATTGCCGGTGTCAATGGCAAGGTGCATGATACTCATGATAGTAAAGATCCAACAGCTACAAAAGTATGTGAAGATGAAGCAATGCTTGAAGAAGCAACTAAATGTCATCGAGATGCAATCAACGATGTGTCTAATGCAGTAGATATACAAGAAAGAACGTTGCAAGACACAAATACACTATTAAAATCTGAAATGGAAGAACACTTGCATTTGAATATTTTTGATAACCTAATAGAATTTGCTGATAACAAAGTCCAGTCTATTGAAAATGATCATGTAAATACAGATTCAACAATGGCAGAATCCACAAGTTCCGAGGAATCTTCAAATGAACTTATTGTACAAGTTGATTACTACCATCGTCATTGTTCTCAACTCAGTGCATCAATCGCAACTACAAAAAATGTCTGTGTGACTGAAAATCAGGCGAGTGATCTTCCTTCAATCGCCCCTGGTTACCCAAAAACAGCTGTAGAACGAATGAGAGAGTATAGAGCTCGGAAAAAGAAAGAAAATCAAATACTGAATCATTCAGAACGTAAAAAATCAGGCGCAGAGCGTGTGCAAGAGTGCAGAGCCCGAAAAAAAACTAAAATCCAATCAGCACATTCAACAATGGCAGATTCCACAAGTTCCGAGAAATCTTCAAATGAATTTATTGTGCAAGCTGATGTCAATCATCGTCATTGTTCTCAACTCAGTGCATCAATCGCAACTACAAACAATGTCTGTGTGACTGAAAATCAGGCGAGTGATCTTCCTTCAATCGCCCCTGGTTACCCAAAAACAGCTGTAGAACGAATGAGAGAGTATAGAGCTCGGAAAAAGAAAGAAAATCAAATACTGAATCATTCAAAACGTAAAAAATCAGGCGCAGAGCGTGCGCAAGAGTGCAGAGCCCGAAAAAAAACTAAAATTCAATCAGCACATTCAACAATGGCAGATTCCACAAGTTCCGAGAAATCTTCAAATGAATTTATTGTGCAAGCTGATGTCAATCATCGTCATTGTTCTCAACTCAGTGCATCAATCGCAACTACAAACAATGTCTGTGTGACTGAAAATCAGGCGAGTGATCTTCCTTCAATCGCCCCTGGTTACCCAAAAACAGCTGCAGAACGAATGAGAGAGTATAGAGCTCGGAAAAAGAAAGAAAATCAAATATTGAATCATTCAAAACGTAAAAAATCAGGCGCAGAGCGTGCGCAAGAGTGCAGAGCCCGAAAAAAAACTAAAATCCAATCAGCAAAATCTAAACCAGACTTAGAAGTCATTGAACCTTTCATAGAAACGATAGATGTGGACCAAGATTTGGACAACGAAACAAGGAAGCACAGGAGAAGAAGCGAAGAGAACACAGAAACCAATGGAGTGATTATTGAAATAAAATCCGAACCTAGAGATTTTGAAGATCTTGCTGACCCATTACAAACTATCAAAATACCATTACTTTTATACACTGGGAAAACAGAACAATTGATCAAAAATGAAACATGCAATACTGATTCTGGTGAAGATGTGGTGAAGACTGACAAAAATATAAACATTATCCCTACTCTTGGTTACCTTCGCGAAACAATCGAAAATTCAAATGAAGAGAAAGCTAAATTAATTGAGGAAATAGTACCGAAAATTGCCGGTGTCAATGGCAAGGTGCATGATACTCATGATAGTAAAGATCTAACAGCTACAAAAGTATGTGAAGATGAAGCAATGCTTGAAGAAGCAACTAAATGTCACCGAGATGCAATCAACGATGCGTCTAATGCAGTCGATACACAAGAAAGAAACTTGCAAGACACAAATACAATATTAAAATCTGAAATGGAAGAACACTTGCATTTGAATATTTTTGATAACGTGATAGAATTTGCTGACAACAATTTCCAGTCTATTGAAAATGATCATGTAAATACAGCTCACGTTATTCAGACCAAAAACGATTTCACTTTACGAAGTCAGTTAAGTTATAAAAATGGCAATAGTACACCAACTTTTGAATCGAAATGTTTCAAGCGTCTCTTTGATCTGAAAGAAGATGAAATGAAAATGTCAAAAAACAATCCGCACGCTTGTAACGAAAATGACAGTTTAAAACAACTGAACATTTCGGAAATACAAACTGATGTTGATAAAATTACGAATCGAAATAATTTTGACATCAGTAATACAATGAACAACACTTTGTTCTTAGAAAGTAAATCTGGTGTACAAAGCGAAACTAGAACAGACGATAGTATGAAAGTGAAAATGTCTAGTCACTTATTTCATAAACCCCGAAATCGATCGTATGATCCTACACAGCTTTGCAAGAATCCGGACTTTAACAAGAAGTTGAAAAGATTAACGGATGCATTCTTAAGTTCGCCGCGTAACAGGGTACTGCTCAATGCTTGCAGGCCGATCACTGTTGATGTAATGAAGGCGATTGAATCCAAACTGTTCAACGGTACAGTGTACTTGAAGGACTGCGACCAACTGAACTCGAATGTTCCAGACCACGGCGCCGTTAGCGACACTGCGACGCGAGTTCCTTCAACAATCGCTTCCCGGAGCTCTACAAATATTCGTTTAGTCAATCCTGATCATTTAATGTCGCTATCGAAATGTTACACATTGAATTTAACACAAGAAAGTTGTGGTGATGCGATGGAGATAAACAGGAAGATCAATCAACCAGATATAACAGAAGTTCCTTGCTCAAATCAATGTTGGCTGACAATTGAAGTACCTTCCCTGACCGTGCGAACTAATAATGAAAGTATAGCTGCAACTCCAGAACTCAAGTCGAACCTATCGTGTACAGAAAAAGAAACCGGTATTTCGTCCAAAAAGAAACCAAGAAAAGAACTTTCAGTTGTGAACGATTGTATTCTTACCCACGACATCCTCAACAAAATGTTAGTAAAAATGGATGAAGATGAACATAATTCTTCTGGTCACTTTTGGTATATCATCTCAGATACTGAAGTCAAACACATAAAATACCATGTTTAA
Protein
MHACVRQIHDISNNLALESSEHQKNPILVSENQLIDEMESNKELWTNMKMHFETNRLPWYHMKTLVLNKLKRLYAADDKSENVTAKDRMSHMEWIIFDFALVHEKIDLIENDGMKCQTQDRQPLIDLFELVTKFDIEDRSGDSLAGAWTAATALYNSRGHQCSPMLLQKRWYQLKEVTRESLYEYWYAYCENSPIPAESIKRPTKLQRAVAQNIADAPQQQWLFEMIAVRLSQHKERIIGMFYSRYPSIITSAFPEWRELIVKRLVIMSEDFEKENWMNNAEASIDTGKFIDFLTLQCLRNNSNYSDDERGRVVKTTKCNLQYGIRLQDSRTFKLIIKIKILHNVFMNRGESQPDLEVIEPFIETIDVDQDLVNETRKYRRRIEESSETNGKVIEIKSEPTDFEDLIDSLQNTKIPLHTLYLHTGKTEKMIENETCNNVSGEDVVKTEKNKDISPNLDYLRETIENSNEAKTTLIEEIVPKIAGVYGNVHDCQESKDPRATKVCEDEAMLEGATKCYRDAINDVSKAVDTQERILQDTNIILKSELEEQLHLNIFDNVIEFADNKVQSIENDHVNTANVIQTKNDLTLQSRLSCEHGNSTSTSELKYLDLKEDAMKMSKNKPHGCNLNDCSKQLTIWEIQTDGSKITNPNNSGISNTVNNTLFLESKSGAQSETRTDDSMKVKMCSYLFHKPRNRSYDPTQLCKNPDFNKKLKRLTNAFLSSPRNRVLLNACRPITVDVMKAIESKLFNGTVYLKDCDQLNSNVPDRGAVSDTATRVPSTIASRSSTNIRLVNPNHLMSLSKCYTSNLTQESCGDAMEINRKINQPDITEVPCSNQCWLTIEVPSLTVRTNNESITATPELNSNLSCTEKGTGISSKKKPRKELSVVNDCILTHDILNKMLVKMDEEEHFYNPSRVTLGASSRILKPSTNTSNPSDEIKICPCRSPAQNTTKIVSAVELLSERNYSAASDSPIVTEKILVDCECKIVEPVLAQEQYQTDQHEMIFMTSNVKTLVIEPIFNHAAEQSKQLIFLASLASQQTLDKRKEIDKSPDFIIENNYDITENIVKVDAISKPNKNILNNLALESSEHQKNHILVSENQLIDEMKSNKELWTNMKMHFETNRLPWYHMKTVILDKLKTLYAADDKSENVSAKDRMSQMDWIIFDFALVHEKIDLIGKDVMRCQTQDRQPLIDLFELVTKFDIEDRSGDSLAGAWTAATALYNSRGRQCSPMLLQKRWYQLKEVTRESLYEYWYASRENSPIPAESIKRPTKLQRAVAQKYPSIITSAFPEWRELIEKRLVIMSEDFEKENWMNNAEASIDTESKPDLQVIEPFIEMIDVDQDLDSETREHGRRSEENTETNGMIIEIKSEPRDFEDLAEPLHTIKTPLLLYTGKTEQLTENETCNTDSGEDVVKTDKNINITPTLDYLRETIEIVPKIAGVNGKVHDTHDSKDPTATKVCEDEAMLEEATKCHRDAINDVSNAVDIQERTLQDTNTLLKSEMEEHLHLNIFDNLIEFADNKVQSIENDHVNTDSTMAESTSSEESSNELIVQVDYYHRHCSQLSASIATTKNVCVTENQASDLPSIAPGYPKTAVERMREYRARKKKENQILNHSERKKSGAERVQECRARKKTKIQSAHSTMADSTSSEKSSNEFIVQADVNHRHCSQLSASIATTNNVCVTENQASDLPSIAPGYPKTAVERMREYRARKKKENQILNHSKRKKSGAERAQECRARKKTKIQSAHSTMADSTSSEKSSNEFIVQADVNHRHCSQLSASIATTNNVCVTENQASDLPSIAPGYPKTAAERMREYRARKKKENQILNHSKRKKSGAERAQECRARKKTKIQSAKSKPDLEVIEPFIETIDVDQDLDNETRKHRRRSEENTETNGVIIEIKSEPRDFEDLADPLQTIKIPLLLYTGKTEQLIKNETCNTDSGEDVVKTDKNINIIPTLGYLRETIENSNEEKAKLIEEIVPKIAGVNGKVHDTHDSKDLTATKVCEDEAMLEEATKCHRDAINDASNAVDTQERNLQDTNTILKSEMEEHLHLNIFDNVIEFADNNFQSIENDHVNTAHVIQTKNDFTLRSQLSYKNGNSTPTFESKCFKRLFDLKEDEMKMSKNNPHACNENDSLKQLNISEIQTDVDKITNRNNFDISNTMNNTLFLESKSGVQSETRTDDSMKVKMSSHLFHKPRNRSYDPTQLCKNPDFNKKLKRLTDAFLSSPRNRVLLNACRPITVDVMKAIESKLFNGTVYLKDCDQLNSNVPDHGAVSDTATRVPSTIASRSSTNIRLVNPDHLMSLSKCYTLNLTQESCGDAMEINRKINQPDITEVPCSNQCWLTIEVPSLTVRTNNESIAATPELKSNLSCTEKETGISSKKKPRKELSVVNDCILTHDILNKMLVKMDEDEHNSSGHFWYIISDTEVKHIKYHV

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
2436
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00498
Exp number, first 60 AAs:
4e-05
Total prob of N-in:
0.00026
outside
1  -  2436
 
 

Population Genetic Test Statistics

Pi
25.508079
Theta
156.013228
Tajima's D
-1.97185
CLR
2851.752566
CSRT
0.015899205039748
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号