SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12050
Pre Gene Modal
BGIBMGA004323
Annotation
PREDICTED:_uncharacterized_protein_LOC101743310_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.059
 

Sequence

CDS
ATGCACGATAACGCTCGTTGTCACACTGCCCGTGTAACAACTGAATACCTCGAAGAAGTCGATATCGCCACATTGGACTGGCCTGCGCTCAACCCTGACTTGAATTCTATTGAGCACGTGTGGGATGAACTGAAGAGAAGGGTTCGTTCCAGAACTTCTGCTCCTTCATGCCTGAATGAGCTGAAATCGGCGTTGATTGAGAAGTGGGAAGATTTATTGAAGCCAATAAAAGACGCTACCCAAAATGAAGCCCATGTTGATGCCAATATTCAACTATTGCGTGATAATTATGATGAAGATGCTACCGAAGACAACCATAACAATCATGAAAATGAAATTGAGATTGATAGAGAAGATCGAATTGGTGAAAATATTATGGATTTTATTGTTGATGGTACTACTCCAGTTTACACAAATTATCGTAAACACAGCACAAGTCATATTGATTTTTATAAAGACTTTACCGGTAATTCATTTGGTCATTCTTGCATTATTTGCGACAGACTATGGTGGAAAAGAGACTTGAAAATGTCGACCAGTAAACATGAGAGTATTTTGAAAACAATCCTGCAGAATTACACACCTGGTGAAATTGTTCAAGTCTGCTATACGTGTTATACATCTTTGGAAAAAGAAAAAATTCCTCTCATGTCAACCTACAATGGTTTTGCATATCCGAAAATTCCATCACATTTACCAACGTTAAACCTTATCGAGCAACGATTGATTTCACCGAGAATACCGTTCATGCAAATTCGTAGGCTGAGACACGTTAATGATCAGTACGGTATTTACGCCCAGATAATTAATGTTCCTATCGAAGTCGATACAATGGTGAAACAATTGCCAAGAAACATTCAAGACGACCATTGCTTTTATGTGCATTTGAAAAAGAAGTTGATTCACAAAACTTGTCATGTCCACGGGCTTGTGAATAATAGTCATATTGAAGAGTGGTTGTCGTATTTAGTATCTACGCCTCTTTATATTTATCATGACATTAAAATCGATGAATCCTTTTTTACCGACAATGGATGTACTTCGCAATTGAATATGGACGAAATAAGTGAACACGTGCCAATTGAAGACAATTTAGTTGCGCAGCAACAAACTCTTTTGTGGAATGATGATTATTTTTTGAGTCTAGCACCCGGTGAATATAACGGTATTTCAATGGATGAACATGCGGAAGAATTATCTTTTCCGACAATCTATGGCGGTCAATTTCGAACATACAGAGATGGTGTTACTGTTACTCCATTCATGCAAGCTACCAGCGAACTCCGGCGTACTGATAGGCGCGCTACTGACCCACAACACCTCTTATACATCGCTGCTAAAATCATGAGGTTGCGAGTTAGTGGATGTGTCAACGTTGCGTTTAAGCATGTCGGACAAGGTACTTCAATTACGAAAGAGACCATTGAATCCGAAGAATATATAAATAATTGTTTAGAAACAAATCTCGCATTCCTTCGCTGCATACCAAATTCCGCTTGGTTTTGGTCAGATCGCAAAAAAGATCTTTTTGCAATGATCAGGCAATTAGGCCCACCAACTGCTTTTATGGGTCTAAGCGCCAATGAAACCGGCTGGGAAAATTTGTTGAAATTATTGTACAAATTGAAAAACGAGGGGGCGGAAATTTCAGATAAGTTTTTAGCAGAAATGAGTTATATGTATAAAGCTCAACTTGTGAATGAAGATGCCGTAACTTGTGCTATTTATTTTAATAAAAAGGTAAATTGTCTATTAAAAGTTTTGCAATCAAAGAAAAGAAGTCCATTCGGAAAACATAGAGTAGTACATTATTTCAAAAGAATAGAATTTCAACATCTTGGTAGCCCACATGCACATATTCTTCTTTGGTTGGAAAATGTTCCTGAAGATTTATTAAGCAATGATCCTGAAGTAATTAAATTAATTGACGAATTGGTTTCTGTGTCAGCGTCAGAGGCGTCTGGAAATATAAAACTAGTAACACACAAACACACATCCACGTGTTATAAAAAAATGAATCCCAATAAAAAGCAAGAATGTAGATTTGGTGCACCATTTATGCCAACAAAAAAAACTATTTATTTGATACCTATGAAAGACACTGATCCCGATTACTCAGAAGCACTTTTCAAAGAATATAAGAATCGATTTAAATTTATAAGAAATAATCTCGAATATTTTGACTACACGAATTTTGATGAATTTTACTCGCATAATTATATTATTTCTGATGATCATTACTACAATATTATTCGTGCTGGTATCAATAGACCAAAATTATTCTATAAAAGAACACCAGCAGAAAAATGGCACAACACTTTCAATCCGTTCGTATTACATCATTTTAAATCGAACATGGACTTTCAGATTATACTAGATGAATATGCTTGTGCAACAAATGTTGTTGAATATGCCAATAAGCATAATAGAGGGATTAGTAATTTGCAAAGACAAATAATTGACATAATGGACGAGAATCCAGAATTCGACATTGTCGATATTACGAACAAAATGAGTATTGACATACTTCAGTCTGTTGAAATGTCGGCACAAGAAGCTGCTTGGTATTTATTAAGAGAACCTGTGGCTAAGTCATCGGTGGCGACAGTCTACATTCCAACGGTATTGCCTACTGAACGCGCAAGAATTAGAAAATCTATGAAGGAACTTGAAGCTTTAGACGATGACTGTACGAACGTTGGGAAAGAGAATTGGTTCGATAAGTACGAGAAAAGACCTGAAGAGCTCCGCGATGTTACGTTAGCACAATTTGTTGCAAAATATTACATAAATAAAAAGGGGACTTACAGTAAAAGAGATACTGCAAGAATAATAAGATATAAGAACTACGATATGGCTGAAAATTACAACGATTATAGGCGTGAGATGGTTCTGTTGCATGTTCCATTTCAAAGTGAAGAAAATGATATTATCGCTGAAAATAAGTTCATTCAAATATACGAGGACAACAAAGATACGATATTAGAACGTAAGAAAGAATTTGAATCAAATTTGGACATAGAGAAAACTTTACAAATTTGTACACAGTTGTGCCGAGAAAACGATGAAGAACAAGAAGACGAAGAATTATTAGGAGCGGCGCATGATGATCCGATTGAAATACCTGATTTCAATTGTATTGCTCAATTCAATCGAGATACTGTTCCAAAAGATATTCTACACAACCCTGCATTGGAAAGCTCTAAAGATCAAAAGAATCATTTATTGGTTTTGGAGAACCAACTGTTAGAAGAAATGAAATCAAGTGAAGAACTCAGGGGAAATATGAATACTCATTTTGAAACTAACAGATTCCCGTGGTATAAGATTAACAGGTACCACATAAAAACTGTAGTACTCAACAAGCTGAAGAATGCGGCCACCGCCCTCTACAACTCGAGGGGTCATCAGTGCTCACCGATGCTACTGCAGAAGCTTTGTTATCAGCTGAAGGAGGTGACCAGGGAATCGCTATATGAGTACTGGTACGCCTCCCGCGAGAACTCTCCTTCGTCGGCCGAGTCTATACAAAGACCAACCAAATTACAGAGAGCTGTGGCCCAGAACGAATCAACTAAAGCATCGACTACTGAGGTACAAACTATAACATCAAGGAAAAGGAAAAAGACAAATGCACAAAAATGTAGAGAATATCGTGAGAAAAAGAAATTACAAAATACAATGGTACAAAACATAACTGCAGAGAGATCAGATGAATGTAGTGAGACTGATCAATTACCAGCCAAAAAACCTAAAACTGATGCAGAAAGAAGAAGAAAATATTATGAAGCGCAGAAATTAAAGAAACAAAAAATTAAAAAAATACCTAAAACTGCTAAACAAAGAAATAAAGAATGTTACGATAGGAAAAAGCAATTTCAGGCTTTAAACGCTTTAAATGCTTTAAATCGTCATTCAGATGTATACCCGTCAATAATAACCAGTGCGTTTCCGGAATGGCTTGAACTGATCGAGAAAAGACTTGTAATAATGTCTGAAGACTTCGAAAAGGAGAAATGGATGAACAACGCGGAAGCTTCTGTAGACAATGAATCTCAACCAGACTTAGAAGTCATTGAACCTTTCATAGAAACGATAGATGTGGACCAAGATTTGGACAACGAAACAAGGAAGCACAGGAGAAGAAGCGAAGAGAACACTGAAACCAATGGAGTGATTATTGAAATAAAATCCGAACCTAGAGATTTTGAAGATCTGGCTGACCCATTGCATACTATCAAAACACCATTACATTTATACACTGGGAAAACAGAACAATTGATCGAAAATGAAACATGCAATACTGATTTTGGTGAAGATGTGGTGAAGACTGATAAAAATATAAACATTACCCCTACTCTTGATTACCTTCGCGAAACAATCGAAAATTCAAATGAAATAATTCCGAAAATTGTTTGTGTTTACGGCAACGTGCATGATACCCATGATAGTAAAGATCTAACATCTACAAAAGTATGTGAAGATGAACCAATGATTGTAGAAGAAACTAAATGTCATCGAGATGACACCAACAATGTGTCTAATGCAGAAGATATACAAGAAAAAGTCTTGCAAGAGACAAATATAATATTAAAGTCTGAAATGGAAGAACAATTGCATTTGAATATTTTTGATAACGTAATAGAATTTGCTGATAACAAAGTCCAGTCTATTGAAAATGATCATGTAAATACAGCCCACGTTATTCAGACCAAAAATGATTTGACTGTACAAAGTCAGTTAAGTTGTGAACATGGAAATAGTACACCAACTTTTGAATCGAAATGTCTCTTTGATTTGAAAGAAGATGCAATGAAAATGTCAAAAAACAATCCGCACTCTTGTAGCGAAAATGACAGTTTAAAACAACTGAACATTTCGGAAATACAAACTGATGTTGATAAAATTACGAATCGAAATAATTCTGACATCAGTAATACAATGAACAACACTTTGTTCTTAGAAAGTAAATCTGTTGCACAAAGCGAAACTAGAACCGACGATAGTATGAAAGTGAAAATGTCTAGTCACTTATTTCATAAACCCCGAAATCGTTCGTATGATCCTACACAGCTTTGCAAGAATCCGGACTTTAACAAGACGTTGAAAAGATTAACGGATGCATTCTTAAGTTCGCCGCGTAACAGGGTACTGCTCAATGCTTGCAGGCCGATCACTGTTGATGTAATGAAGGCGATTGAATCCAAACTGTTCAACGGTACAGTGTACTTGAAGGACTGCGACCAACTGAACTCGAATGTTCCAGACCGCGGCGCCGTTAGCGACACTGCGACGCGAGTTTCTTCAACAATCGCTTCCCGGAGCAAACGCAGAGCTTCTACAAATATTCGTTTAGTCAATCCTGATCATTTAATGCCGCTATCGAAATGTTACACATCTAATTTAACACAAGAAAGTTGTGGCGATGCGATGGAGATAAACAGGAAGATCAATCAACCAGATATAATAGAAGTTCCTTGCTCAAATCAATGTTGGCTGACAATTGAAGTACCTCCCCTGACCGTGCGAACTAATAATGAAAGTATAGCTGCAAATCCAGAACTCAATTCAAACCTATCATGTGCAGAAAAAGGAACTGGTATTTCGTCCAAAAAGAAACCAAGAAAAGAACTTTCAGTTGTGAATGATTGTATTCTTACCCACAACATCCTCAACAAAATGGTAGTAAAAATGGATGAAGAAGAACGTTTTTATAATCCTTCCAGAGTAACTTTTGGTGCATCGTCTCGGATACTGAAGCCAAGCACAAACACAAGTAATCCCAGTGATGAAATCAAAATCCGTCCCCGTAGGTCTCCTGCACAAAATACAACAAAAATGGTGTCAGCTGTCGAACTGTTGAGTGAGCGAAATTATTCCGCTGCGAGTGACAGCCCTATCATGGCAGACAACATCGTAATCGATAGTGAAAGTAAAATCGTTGAACCGGTATTCGCACAGGAACAATACCAGACCGACAAACATGAAATTATAAATACGACATCTAATGCAAAGACTCTGGTGATAGAGCCAATTTTCAATCATGTTACCGAAAAATCTAAAAAACTTATGTTTTTGGCGTCGCTTGCGTCTCAACAAACGTTAGATAAACAGAAAGAAATACATAAATCTCCTTATTTTATCATTGAAAACAACTAA
Protein
MHDNARCHTARVTTEYLEEVDIATLDWPALNPDLNSIEHVWDELKRRVRSRTSAPSCLNELKSALIEKWEDLLKPIKDATQNEAHVDANIQLLRDNYDEDATEDNHNNHENEIEIDREDRIGENIMDFIVDGTTPVYTNYRKHSTSHIDFYKDFTGNSFGHSCIICDRLWWKRDLKMSTSKHESILKTILQNYTPGEIVQVCYTCYTSLEKEKIPLMSTYNGFAYPKIPSHLPTLNLIEQRLISPRIPFMQIRRLRHVNDQYGIYAQIINVPIEVDTMVKQLPRNIQDDHCFYVHLKKKLIHKTCHVHGLVNNSHIEEWLSYLVSTPLYIYHDIKIDESFFTDNGCTSQLNMDEISEHVPIEDNLVAQQQTLLWNDDYFLSLAPGEYNGISMDEHAEELSFPTIYGGQFRTYRDGVTVTPFMQATSELRRTDRRATDPQHLLYIAAKIMRLRVSGCVNVAFKHVGQGTSITKETIESEEYINNCLETNLAFLRCIPNSAWFWSDRKKDLFAMIRQLGPPTAFMGLSANETGWENLLKLLYKLKNEGAEISDKFLAEMSYMYKAQLVNEDAVTCAIYFNKKVNCLLKVLQSKKRSPFGKHRVVHYFKRIEFQHLGSPHAHILLWLENVPEDLLSNDPEVIKLIDELVSVSASEASGNIKLVTHKHTSTCYKKMNPNKKQECRFGAPFMPTKKTIYLIPMKDTDPDYSEALFKEYKNRFKFIRNNLEYFDYTNFDEFYSHNYIISDDHYYNIIRAGINRPKLFYKRTPAEKWHNTFNPFVLHHFKSNMDFQIILDEYACATNVVEYANKHNRGISNLQRQIIDIMDENPEFDIVDITNKMSIDILQSVEMSAQEAAWYLLREPVAKSSVATVYIPTVLPTERARIRKSMKELEALDDDCTNVGKENWFDKYEKRPEELRDVTLAQFVAKYYINKKGTYSKRDTARIIRYKNYDMAENYNDYRREMVLLHVPFQSEENDIIAENKFIQIYEDNKDTILERKKEFESNLDIEKTLQICTQLCRENDEEQEDEELLGAAHDDPIEIPDFNCIAQFNRDTVPKDILHNPALESSKDQKNHLLVLENQLLEEMKSSEELRGNMNTHFETNRFPWYKINRYHIKTVVLNKLKNAATALYNSRGHQCSPMLLQKLCYQLKEVTRESLYEYWYASRENSPSSAESIQRPTKLQRAVAQNESTKASTTEVQTITSRKRKKTNAQKCREYREKKKLQNTMVQNITAERSDECSETDQLPAKKPKTDAERRRKYYEAQKLKKQKIKKIPKTAKQRNKECYDRKKQFQALNALNALNRHSDVYPSIITSAFPEWLELIEKRLVIMSEDFEKEKWMNNAEASVDNESQPDLEVIEPFIETIDVDQDLDNETRKHRRRSEENTETNGVIIEIKSEPRDFEDLADPLHTIKTPLHLYTGKTEQLIENETCNTDFGEDVVKTDKNINITPTLDYLRETIENSNEIIPKIVCVYGNVHDTHDSKDLTSTKVCEDEPMIVEETKCHRDDTNNVSNAEDIQEKVLQETNIILKSEMEEQLHLNIFDNVIEFADNKVQSIENDHVNTAHVIQTKNDLTVQSQLSCEHGNSTPTFESKCLFDLKEDAMKMSKNNPHSCSENDSLKQLNISEIQTDVDKITNRNNSDISNTMNNTLFLESKSVAQSETRTDDSMKVKMSSHLFHKPRNRSYDPTQLCKNPDFNKTLKRLTDAFLSSPRNRVLLNACRPITVDVMKAIESKLFNGTVYLKDCDQLNSNVPDRGAVSDTATRVSSTIASRSKRRASTNIRLVNPDHLMPLSKCYTSNLTQESCGDAMEINRKINQPDIIEVPCSNQCWLTIEVPPLTVRTNNESIAANPELNSNLSCAEKGTGISSKKKPRKELSVVNDCILTHNILNKMVVKMDEEERFYNPSRVTFGASSRILKPSTNTSNPSDEIKIRPRRSPAQNTTKMVSAVELLSERNYSAASDSPIMADNIVIDSESKIVEPVFAQEQYQTDKHEIINTTSNAKTLVIEPIFNHVTEKSKKLMFLASLASQQTLDKQKEIHKSPYFIIENN

Summary

Uniprot
ProteinModelPortal
PDB
5CR4     E-value=8.71466e-10,     Score=159

Ontologies

GO

Topology

Length:
2052
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00481999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00026
outside
1  -  2052
 
 

Population Genetic Test Statistics

Pi
227.435886
Theta
207.231391
Tajima's D
0.600158
CLR
0.238558
CSRT
0.541022948852557
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号