SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12049
Pre Gene Modal
BGIBMGA004321
Annotation
PREDICTED:_uncharacterized_protein_LOC101743310_isoform_X3_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.078
 

Sequence

CDS
ATGTCGACCAGTAAACATGAGAGTATTTTGAAAACAATCCTGCAGAATTATACCCCTGGTGAAATAGTTCAAGTCTGCTATACGTGCTATACATCTTTGGAAAAAGAAAAAATTCCTCTTATGTCAACCTACAATGGTTTTGCATATCCGAAAATTCCATCACATTTACCAACGTTAAACCTTATCGAGCAACGATTGATTTCACCGAGACTAGCGTTCATGCAAATTCGTAGGCTGAGACACGTTAATGATCAGTATGGTATTTACGCCCAGATAATTAATGTTCCTATCGAAGTCGATACAATGGTGAAACAATTGCCAAGAAAAATTCAAGACGACCATTGCTTTTATGTGCATTTGAAAAAGAAGTTGATTCACAAAACTAGTCATGTCCACGGGCTTGTGAATAAGAGTCATATTGAAGAGTGGTTGTCGTATTTAGTATCTACGCCTCTTTATATTTATCATGACATTAAAATCGATGAGTCTTTTTTTACCGACAATGAACGTACTTCGCAATTGAATATGGATGAAATAAGTGAACACGTGCCAATTGAAGACAATTTAGTTGCGCAGCAACAAACTCTTTTGTGGAATGATGATTATTTTTTGAGTCTAGCACCCGGTGAATATAACAGGCCAGCCAGTATTTTAATAGATGAACATGCGGAAGAATTATCTTTTCCGACAATCTACGGCGGTCAGTTTCGAACATATAGAGATGGTGTTACTGTTACTCCATTCATGCAAGCTACCAGCGAACTCCGGCGTACTGATAGGCGCGCTACTGACCCACAACACCTCTTATACATCGCTGCTAAAATCATGAAGTTGCGAGTTAGTGGATGTGTCAACGTTGCGTTTAAGCATGTCGGACAAGGTACTTCAATTACGAAAGACACCATTGAATCTGAAGAATATATAAATAATTGTTTAGAAACAAATCTCGCATTCCTTCGCTGCATACCAAATTCCGCTTGGTTTTGGTCAGATCGCAAAAAAGATCTTTTTGCAATGATCAGGCAATTAGGACCACCAACTGCTTTTATGGGTCTAAGCGCCAATGAAACGGGCTGGGAAAATTTGTTGAAATTATTGTACAAATTGAAAAACGAGGGGGCGGAAATTTCAGATAAGTTTTTAGCAGAAATAAGTTATATGTATAAAGCTCAACTTGTGAATGAAGATGCCGTAACTTGTGCTATTTATTTTAATAAAAAGGTAAATTGTCTATTAAAAGTTTTGCAATCAAAGAAAAGAAGTCCATTCGGAAAATATAGAGTAGTACATTATTTCAAAAGAATAGAATTTCAACATCTTGGTAGCCCACATGCACATATTCTTCTTTGGTTGGAAAATGTTCCTGAAGATTTATTGAGCAATGATCCTGAAGTTATTAAATTAATTGACGAATTGGTTTCTGTGTCAGCGTCAGAGGCGTCTGGAAATATAAAACTAGTAACACACAAACACACATCCACGTGTTATAAAAAAATGAATCCCAATAAAAAGCAAGAATGTAGATTTGGCGCACCATTTATGCCAACAAAAAAAACTGTTTATTTGATACCTATGAAAGACACTGATCCCGATTACTCAGAAGCACTTTTCAAAGAATATAAGAAACGATTTAAATTTATAAGAAATAATCTCGAATATTTTGACTACACGAATTTTGATGAATTTTACTCGCATAATTATATTATTTCTGATGATCATTACTACAATATTATTCGTGCTGGTATCAATAGACCAAAATTATTCTATAAAAGAACACCAGCAGAAAAATGGCACAACTCTTTCAATCCGTTCGTATTACATCATTTTAAATCGAACATGGACTTTCAGATTATACTAGATGAATATGCTTGTGCAACATATGTTGTTGAATATGCCAATAAGCATAATAGAGGGATTAGTAATTTGCAAAGACAAATAATTGACATAATGGACGAGCATCCAGAATTCGACATTGTCGATATCACGAACAAAGTGAGTATTGATATACTTCAGTCTGTTGAAATGTCGGCACAAGAAGCTGCTTGGTATTTATTAAGAGAACCTGTGGCTAAGTCATCGGTGGCGACAGTCTACATTCCAACGGTATTGCCTACTGAACGCGCAAGAATTAGAAAATCTATGAAGGAACTTGAAACTTTAGACGATGACTGTACGAACGTTGGGAAAGAGAATTGGTTCGATAAGTACGAGAAAAGACCTGAAGAGCTCCGCGATGTTACGTTAGCACAATTTGTTGCAAAATATTACATAAATAAAAAGGGGACTTACAGTAAAAGAGATACTGCAAGAATAATAAGATACAAGAACTACGATATGGCTGAAAATTACAACGATTATAGGCGTGAGATGGTTCTGTTGCATGTTCCATTTCAAAGTGAAGAAAATGATATTATCGCTGAAAATAAGTTTATTCAAATATACGAGGACAACAAAGATACGATATTAGAACGTAAGAAAGAATTTGAATCAAATTTGGACATAGAGAAAACTTTACAAATTTGTACACAGTTGTGCCGAGAAAACGATGAAGAACAAGAAGACGAAGAATTATTAGGAGCGGCGCATGATGATCCGATTGAAATACCTGATTTCAATTGTATTGCTCAATTCAATCGAGATACTGTTCCAAAAGATATTCTACACAACCTTGCATTGGAAAGCTCTAAACATCAAAAGAATCATTTATTGGTTTTGGAGAACCAACTGTTAGAAGAAATGAAATCAAGTAAAGAACTCAGGGGAAATATGAAGACTCATTTTGAAACTAACAGATTCCCGTGGTATAAGATTAACAGGTACCACATGAAAACTGTAGTACTCAACAAGCTGAAGACACTTTATGCGGCAGACGATAAGAGTGAAAATGTATTGGCTAAGGACCGAATGTCCCAGACGGATTGGATTATATTTGACTTTGCTCTCGTCCATGAGAAAATAGATCTAATTGAAAAAGATGGTATGAGATGTCAAACTCAGGATCGTCAGCCGTTGATTGATCTCTTCGAGCTGGTGACGAAGTTTGACATAGAGGACAGGTCCGGAGACAGTCTGGCCGGCGCCTGGACTGCGGCCACCGCCCTCTACAACTCGAGGGGTCGTCAGTGCTCACCGATGCTACTGCAGAAGCGTTGGTATCAGCTGAAGGAGGTGACCAGGGAATCGCTATATGAGTACTGGTACGCCTCCCGCGAGAACTCTCCTTCGTCGGCCGAGTCTATACAAAGCGCAACCAAATTACAGAGAGCTGTGGCCCAAAAACGAGCATACGGCCCACCTGATGGTAAGTGGTCACCGTCGCTCATGGACGTCAGCAATGTCAGGGGCAGAGCCAAGCCGCTGCCTACCATAAAGTACTCTCCGCAAGCCTCGTTTGAAGAAGGACATGTCATAGCGCTCGGAAAACACCGTGGAGGGGAGTTCATTCCAAAGCCGGATGCGGTTCCAGATAATATGGATGAACTCTGCTCCGATGGCGGGAGGTGCGATGATAAAAAGGAGATGAGGGAATCATCTCGAATAATTCCTCAGAGCATTCCCCATGGACCATGCGGTATAAAACACAGAGAGAACCGAAGTCCCTCCGTAGACCCAGAGGTTCCAAGCGATCCGCGAGCGCAGGACTATCGACCATCCGAACAGCCCGTTTCTGTATGGAGTCAAATGGAAGTAGCTGGTATTTGGGAGCCCCGGCCCAGAGAATCTCAACCAGACTTAGAAGTCATTGAACCTTTCATAGAAACGATAGATGTGGACCAAGATTTGGACAACGAAACAACGAAGCTCGGGAGAAGAAGCGAAGAGAACACTGAAACCAATGGAATGATGATTATTGAAATAAAATCCGAACCTAGAGATTTTGAAGATCTGGCTGACCCATTACAAACTATTAAAATACCATTACTTTTACACACCGGGAAAACAGAACAATTGATCAAAAATGAAACATGCAATACTGATTTTGGTGAAGATGTGGTGAAGACTGAAAAAAATCAAAATATTTCCCCAACTCTTGATTACCTTCGCGAAACAGTCGAAAATTCAAATGAAATAGTTCCGAAAATTGTCTGTGTTTACGGCAACGTGCATGATACCCATGATAGTAAAGATCTAACATCTACAAAAGTATGTGAAGATGAACCAATGATTGTAGAAGAAACTAAATGTCATCGAGATGACACCAACAATGTGTCTAATGCAGAAGATATACAAGAAAAAGTCTTGCAAGAGACAAATATAATATTAAAGTCTGAAATGGAAGAACAATTGCATTTGAATATTTTTGATAACGTAATAGAATTTGCTGATAACAAAGTCCAGTCTATTGAAAATGATCATGTAAATACAGTGCACGTTATTCAGACCAAAAACGATTTCACTTTACAAAGTCGGTTAAGTTGTGAATATGGAAATAGTGCATCGACTTCTGAATTAAAATGTCTCTTTGATTTGAAAGAAGATGCAATGAAAATGTCAAAAAACAAGCTGCAGGGTTGTAACTTAAAAGACAGTTTAAAACAACTGAACATTTCGGAAATACAAACTGATGTTAATAAGATTACGAATCGAATTAATTCTGACATCAGTAATACAATGAACAACACTTTGTTCTTAGAAAGTAAATCCGGTGCACAAAGTGAAACTAGAACAGACGATAGTATGAAAGTGAAAATGTCTAGTTACTTATTTCATAAACCCCGAAATCGTTCGTATGATCCTACACAGCTTTGCAAGAATCCGGACTTTAACAAGAAGTTAAAAAGATTAACGGATGCATTCTTAAGTTCGCCGCGTAACAGGGTACTGCTCAATGCTTGCAGGCCGATCACTGTTGATGTAATGAAGGCGATTGAATCCAAACTGTTCAACGGTACAGTGTACTTGAAGGACTGCGACCAACTGAACTCGAATGTTCCAGACCGCGGCGCCGTTAGCGACACTGCGACGCGAGTTCCTTCAACAATCGCTTCCCGGAGCTCTACAAATATTCGTTTAGTCAATCCTGATCATTTAATGTCGCTATCGAAATGTTACACATCGAATTTAACACAAGAAAGTTGTGGTGATGCGATGGAAATAAACAGGAAGATCAATCAACCAAATATAACAGAAGTTCCTTGCTCAAATCAAAGTTGGCTGACAATTGAAGTGCCTCCCCTTACCGTGCGAACTAATAATGAAAGCATAACAACTCCAGAACCCAATTCAACCCTGTCATGTAAAGAAAAAGAAACCGGTATTTCGTCCAAAAAGAAACCAAGAAAAGAATTTTCAGTTGTGAATGATGGTTTTCTTACCCACGACATCCTCAACAAAATGGTAGTAAAAATGGATGAAGAAGAACGTTTTTATAATCCTTCCAGAGTAACTTTTGGTGCATCGTCTCGGATACTGAAGCCAAGCACAAACACAAGTAATCCCAGTGATGAAATCAAAATCCGTCCCTGTAGGTCTCCTGCACAAAATACAACAAAAATGGTGTCAGCTGTCGAACTGTTGAGTGAGCGAAATTATTCCGCTGCGAGTGACAGCCCTATCATGGCAAACAACATCGTAATCGACAGTGAAAGTAAAATCGTTGAACCGGTATTCGCACAGGAACAATACCAGACCGACAAACATGAAATTATAAATACGACATCTAATGCAAAGACTCTAGTGATAGAGCCAATTTTCAATCATGTTACCGAAAAATCTAAAAAACTTATGTTTTTGGCGTCGCTTGCGTCTCAACAAACGTTAGTTAAACGGAAAGAAATAGATAAATCTCCTTAG
Protein
MSTSKHESILKTILQNYTPGEIVQVCYTCYTSLEKEKIPLMSTYNGFAYPKIPSHLPTLNLIEQRLISPRLAFMQIRRLRHVNDQYGIYAQIINVPIEVDTMVKQLPRKIQDDHCFYVHLKKKLIHKTSHVHGLVNKSHIEEWLSYLVSTPLYIYHDIKIDESFFTDNERTSQLNMDEISEHVPIEDNLVAQQQTLLWNDDYFLSLAPGEYNRPASILIDEHAEELSFPTIYGGQFRTYRDGVTVTPFMQATSELRRTDRRATDPQHLLYIAAKIMKLRVSGCVNVAFKHVGQGTSITKDTIESEEYINNCLETNLAFLRCIPNSAWFWSDRKKDLFAMIRQLGPPTAFMGLSANETGWENLLKLLYKLKNEGAEISDKFLAEISYMYKAQLVNEDAVTCAIYFNKKVNCLLKVLQSKKRSPFGKYRVVHYFKRIEFQHLGSPHAHILLWLENVPEDLLSNDPEVIKLIDELVSVSASEASGNIKLVTHKHTSTCYKKMNPNKKQECRFGAPFMPTKKTVYLIPMKDTDPDYSEALFKEYKKRFKFIRNNLEYFDYTNFDEFYSHNYIISDDHYYNIIRAGINRPKLFYKRTPAEKWHNSFNPFVLHHFKSNMDFQIILDEYACATYVVEYANKHNRGISNLQRQIIDIMDEHPEFDIVDITNKVSIDILQSVEMSAQEAAWYLLREPVAKSSVATVYIPTVLPTERARIRKSMKELETLDDDCTNVGKENWFDKYEKRPEELRDVTLAQFVAKYYINKKGTYSKRDTARIIRYKNYDMAENYNDYRREMVLLHVPFQSEENDIIAENKFIQIYEDNKDTILERKKEFESNLDIEKTLQICTQLCRENDEEQEDEELLGAAHDDPIEIPDFNCIAQFNRDTVPKDILHNLALESSKHQKNHLLVLENQLLEEMKSSKELRGNMKTHFETNRFPWYKINRYHMKTVVLNKLKTLYAADDKSENVLAKDRMSQTDWIIFDFALVHEKIDLIEKDGMRCQTQDRQPLIDLFELVTKFDIEDRSGDSLAGAWTAATALYNSRGRQCSPMLLQKRWYQLKEVTRESLYEYWYASRENSPSSAESIQSATKLQRAVAQKRAYGPPDGKWSPSLMDVSNVRGRAKPLPTIKYSPQASFEEGHVIALGKHRGGEFIPKPDAVPDNMDELCSDGGRCDDKKEMRESSRIIPQSIPHGPCGIKHRENRSPSVDPEVPSDPRAQDYRPSEQPVSVWSQMEVAGIWEPRPRESQPDLEVIEPFIETIDVDQDLDNETTKLGRRSEENTETNGMMIIEIKSEPRDFEDLADPLQTIKIPLLLHTGKTEQLIKNETCNTDFGEDVVKTEKNQNISPTLDYLRETVENSNEIVPKIVCVYGNVHDTHDSKDLTSTKVCEDEPMIVEETKCHRDDTNNVSNAEDIQEKVLQETNIILKSEMEEQLHLNIFDNVIEFADNKVQSIENDHVNTVHVIQTKNDFTLQSRLSCEYGNSASTSELKCLFDLKEDAMKMSKNKLQGCNLKDSLKQLNISEIQTDVNKITNRINSDISNTMNNTLFLESKSGAQSETRTDDSMKVKMSSYLFHKPRNRSYDPTQLCKNPDFNKKLKRLTDAFLSSPRNRVLLNACRPITVDVMKAIESKLFNGTVYLKDCDQLNSNVPDRGAVSDTATRVPSTIASRSSTNIRLVNPDHLMSLSKCYTSNLTQESCGDAMEINRKINQPNITEVPCSNQSWLTIEVPPLTVRTNNESITTPEPNSTLSCKEKETGISSKKKPRKEFSVVNDGFLTHDILNKMVVKMDEEERFYNPSRVTFGASSRILKPSTNTSNPSDEIKIRPCRSPAQNTTKMVSAVELLSERNYSAASDSPIMANNIVIDSESKIVEPVFAQEQYQTDKHEIINTTSNAKTLVIEPIFNHVTEKSKKLMFLASLASQQTLVKRKEIDKSP

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
1930
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01156
Exp number, first 60 AAs:
0.00856
Total prob of N-in:
0.00058
outside
1  -  1930
 
 

Population Genetic Test Statistics

Pi
233.711264
Theta
198.013751
Tajima's D
0.888669
CLR
0.167425
CSRT
0.628318584070796
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号