SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12048
Pre Gene Modal
BGIBMGA004320
Annotation
PREDICTED:_uncharacterized_protein_LOC105841508_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.208
 

Sequence

CDS
ATGAAACCGGATAGCGAAATCTGGGCGAATATGAAGACGCACCTCGAAAGCAACAAATTGCTGTGGGACCACATGAAAACCGTAGTACTGAACAAACTGAAGAAGCTTTACGCGGCAGAAGATAAGAACGAAAACTTGCCGGCTAACGATCGAATGTCCCAGGCGGATTGGCTATTATTCGACTTTGCTCTCGTCCACGAGAAAATAGACCTTATCGAAAGAGATGGTATGAGATCTCAAACTCAGGATCTTCAGCCGTTGATTGATCTCTTCGAGCTGGTGACGAAGTTTGACATAGAGGACAGGTCCGGAGACAGTCGGGCCGGCGCCTGGACTGCGGCCACCGCCCTCTACAACTCGAGGGGTCATCAGTGCTCACCGATGCTACTGCAGAAGCGTTGGTATCAGCTGAAGGAGGTGACCAGGGAATCGCTATATGAGTACTGGTACGCCTCCCGCGTGAACTCTCCTTCGTCGGCCGAGTCTATACCAAGACCAACCAAATTACAGAGAGCTGTGGCCCAGAAATACCCGTCAATAATAACGAGTGCGTTTCCGGAATGGCGGGAACTGATCGAGAACAGACTTGTAGTAATGTCTGAAGACCTCGAAAGGAATAATTGGATGAGCAACGCGGAATCTCCGATAGACACTGAATCTAAACCAGACTTAGAAGTCGTTGAACCTTTCATAGAAACGATAGATGTGGACCAAGATTTGGACAACGAAACAAGGGAGCACGGGAGAAGAAGCGAAGAGAACACTGAAACCAATGGAATGATTATTGAAATAAAATCCGAACCTAGAGATTTTGAAGATCTGATTGACTCATTACAAAATACCGAAATACCATTACACACTGGCAAAACAGGAAAAATGATCGAAAATGAAACATGCAATAATGTTTCTGGTGAAGATGTGGTAAAGACCGAAAAATATAGAAATATTTCTCCCATTCTTGATCACCTTCGCGACACGACCCAAAATTCAAATGAAACAGAAGCCAAATTGAATATGGATATAGTACCGAAAATTGCTGGTGTCTACGGCAACGTCGATATGTTAAGTAAAATTATAAATTTGCATGATTCTCAAGTAAGTACAGAACCAACAGCTACAAAAGTAGTTGAAGATGAATCAATGAGAGGAAATGAAATTGAATTTCACCAAGACGATGCAACTAGCAATGTTTCTAATGCAATAAAAGACAGAGGCTTGGAAGACACAAATATAATGTTGAAATGTGAAACAGAAGACCCATCGCATTTGAATATCTTTGATAATGGAATAGAATTTGCTGATAATAAAATTCAGTTTATTGAAAAGGACCATGTAAATACAGCTTACGCTATTCAGATAAAGAATGAATTCAGGTTACCGAATACAAATTGTGAAAATGCAAATAGTACACAAACTTCTGAATTTACCAAGCAACCATTTGTCTTAAAGGAAGGCGAAGAGAAAATGTCAAAAACCGAGTCGCATCGTAATGACATAAATAACAAAAGCTCAAAACAACTGAACGTTTCCGAAATCGCTGCTAAACGACCGACTGAAATCAGTAAAGTGATGACTGGAAATAATTCTGATATTAACAATACAACAAACAACGACTTGTTCGCGGAAAGTAAAACTGCTGAAAAAAATGAGAATAGAACAGACGATAGTATGAAAGTGAAGATGTCTAGTTACTTATTTCATAAACCCCGAAATCGTTCGTATGATCCTACACAGCTTTGCAAGAATCCGGACTTTAACAAGAAGTTGAAAAGATTAACGGATGCATTCTTAAGTTCGCCGCGTAACAGGGTACTGCTCAATGCTTGCAGGCCGATCACTGTTGATGTAATGAAGGCGATTGAATCCAAACTGTTCAACGGTACAGTGTACTTGAAGGACTGCGACCAACTGAACTCGAATGTTCCAGACCGCGGCGCCGTTAGCGACACTGCGACGCGAGTTCCTTCAACAATCGCTTCCCGGAGCTCTACAAATATTCGTTTAGTCAATCCTGATCATTTAATGTCGCTATCGAAATGTTACACATCGAATTTAACACAAGAAAGTTGCGGTGATGCGATGGAGATAAACAGGAAGATCAATCAACCTGATATAACAGAAGTTCCTTGCTCAAATCAAAGTTGGCTGACAATTGAAGTGCCTCCCCTTACCGTGCGAACTAATAATGAAAGCATAACAACTCCAGAACCCAATTCAACCCTGTCATGTAAAGAAAAAGAAACCGGTATTTCGTCCAAAAAGAAACCAAGAAAAGAATTTTCAGTTGTGAATGATGGTTTTCTTACCCTCGACCTCCTCAACAAAATGTTACTGAAAATCGATGAGGATGAACATTTTTATAATCCTTCCAAAGTAAATTTTGGTACATCGTCTCAGATACTGAAGCCAAACGCAAAAAAATTCATTCTTCAGAAAAACAAAAGTATTCCCAATGTTGAAATACAAATCTGTCCCTGTAGGTCTTCTGTACAAAATACAACAAAAATGGTGTCAGCTGTCGAACTGTTGAGTGAGCGAAATTATTCCGCTGCGAGTGACAGTCCTAACGTTACAGACAACATCGTGGCTGACAGTGAATGTAAAATCGTTGAACCGGTATTCGCGCAGGAACAATATCAGACTTACAAACATGAAATGATAAATATGACATCTAACGTAAAGACTCTAGTGATAGAACCAATCTTCAATCATGTTGCCGAACAATCTAAAAAACTTATGTTTTTGGCGTCGCTTGCGTCTCAACAAACGTTGGATAAACGGAAAGCAATAGATGAAACTTCTTACGTTAATGTAGAAAATAACTACGAGATCGCTGGAAAGATCGTAAAAGTTGACGGAAACTTCAATCTAAATAAAAGTATAAATAATGCAAACCCTCCCCACAGTAGACGCATATTGGGTCAAACACGTAAACCACGTGTAAAAAAATTTAGTGATATACTTACATAG
Protein
MKPDSEIWANMKTHLESNKLLWDHMKTVVLNKLKKLYAAEDKNENLPANDRMSQADWLLFDFALVHEKIDLIERDGMRSQTQDLQPLIDLFELVTKFDIEDRSGDSRAGAWTAATALYNSRGHQCSPMLLQKRWYQLKEVTRESLYEYWYASRVNSPSSAESIPRPTKLQRAVAQKYPSIITSAFPEWRELIENRLVVMSEDLERNNWMSNAESPIDTESKPDLEVVEPFIETIDVDQDLDNETREHGRRSEENTETNGMIIEIKSEPRDFEDLIDSLQNTEIPLHTGKTGKMIENETCNNVSGEDVVKTEKYRNISPILDHLRDTTQNSNETEAKLNMDIVPKIAGVYGNVDMLSKIINLHDSQVSTEPTATKVVEDESMRGNEIEFHQDDATSNVSNAIKDRGLEDTNIMLKCETEDPSHLNIFDNGIEFADNKIQFIEKDHVNTAYAIQIKNEFRLPNTNCENANSTQTSEFTKQPFVLKEGEEKMSKTESHRNDINNKSSKQLNVSEIAAKRPTEISKVMTGNNSDINNTTNNDLFAESKTAEKNENRTDDSMKVKMSSYLFHKPRNRSYDPTQLCKNPDFNKKLKRLTDAFLSSPRNRVLLNACRPITVDVMKAIESKLFNGTVYLKDCDQLNSNVPDRGAVSDTATRVPSTIASRSSTNIRLVNPDHLMSLSKCYTSNLTQESCGDAMEINRKINQPDITEVPCSNQSWLTIEVPPLTVRTNNESITTPEPNSTLSCKEKETGISSKKKPRKEFSVVNDGFLTLDLLNKMLLKIDEDEHFYNPSKVNFGTSSQILKPNAKKFILQKNKSIPNVEIQICPCRSSVQNTTKMVSAVELLSERNYSAASDSPNVTDNIVADSECKIVEPVFAQEQYQTYKHEMINMTSNVKTLVIEPIFNHVAEQSKKLMFLASLASQQTLDKRKAIDETSYVNVENNYEIAGKIVKVDGNFNLNKSINNANPPHSRRILGQTRKPRVKKFSDILT

Summary

Ontologies

GO

Topology

Length:
989
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00019
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  989
 
 

Population Genetic Test Statistics

Pi
179.418745
Theta
155.602398
Tajima's D
0.245806
CLR
0.970999
CSRT
0.438178091095445
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号