SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12047
Annotation
AF461149_1_transposase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.345
 

Sequence

CDS
ATGATAAGGTGTACGCACACAGTAGTGAAGAAGCGAGCAACCGTATTCCGCGTGTCCAACGAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGAGAATTCCATAGAGCGAAGAGCACACAAGACTGGCCGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAAATTATAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MIRCTHTVVKKRATVFRVSNEALGIPTRFGAREFHRAKSTQDWPAAREIDFIRHEDWPSSSPDLNPLNYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKACIQNHGGHFE

Summary

Similarity
Belongs to the TGF-beta family.
EMBL
RSAL01000209    RVE44259.1    AF461149    AAN06610.1    AB363028    BAG15927.1    + More
AB473770    BAH20555.1    RSAL01000931    RVE41042.1    RSAL01000021    RVE52408.1    AB363006    AB363010    AB363014    BAG15923.1    BAG15924.1    AB363018    BAG15926.1    RSAL01000470    RVE41612.1    RSAL01000300    RVE42771.1    RSAL01000012    RVE53510.1    RSAL01000114    RVE46946.1    RSAL01000174    RVE45058.1    RSAL01000063    RVE49524.1    RSAL01000140    RVE46091.1    RSAL01000387    RVE42024.1    RSAL01000004    RVE54604.1    RSAL01000189    RVE44738.1    RSAL01000200    RVE44486.1    U47917    AAB47739.1    UYSL01020631    VDL75518.1    LNIX01000030    OXA41211.1    UYSL01020109    VDL72812.1    UYSL01022144    VDL79905.1    UYSL01020934    VDL76658.1    UYSL01002425    VDL65835.1    JARK01001601    EYB87313.1    UYSL01020634    VDL75527.1    UYSL01009772    VDL68385.1    UYSL01023059    VDL81638.1    DS268612    EFO94085.1    KI662043    ETN73029.1    UYSL01023743    VDL82626.1    JARK01001411    EYC06502.1    UYSL01022000    VDL79615.1    UYSL01019770    VDL69590.1    JARK01001658    EYB84158.1    PDUG01000006    PIC20538.1    JARK01001337    EYC34439.1    CAVP010058755    CDL95145.1    PDUG01000001    PIC51673.1    PDUG01000005    PIC29926.1    UYSL01019810    VDL70150.1    PIC23776.1    KN729202    KIH62598.1    UYSL01019905    VDL71189.1    JARK01000255    EYC39473.1    UYSL01021399    VDL78127.1    JARK01001471    EYB97976.1    JOJR01000015    RCN51257.1    PDUG01000012    PIC13506.1    KN726559    KIH67820.1    UZAH01026445    VDO80847.1    PDUG01000004    PIC32571.1    JOJR01000583    RCN36166.1    UZAH01001595    VDO19836.1    KN728435    KIH63782.1    DS268420    EFO87874.1    KE129060    EPB65323.1    DS268747    EFP00909.1    HE601413    CAS00486.1    UZAH01031030    VDP13493.1    DS268433    EFO97645.1    DS268466    EFP06959.1    DS268508    EFO83264.1    DS268421    EFO88618.1    DS268428    EFO94379.1    DS268492    EFP11674.1    DS268673    EFO98001.1    DS268606    EFO93488.1   
Pfam
PF07776   zf-AD        + More
PF00019   TGF_beta
PF00431   CUB
PF16095   COR
PF00069   Pkinase
PF00722   Glyco_hydro_16
PF13358   DDE_3
PF00292   PAX
PF00520   Ion_trans
PF10320   7TM_GPCR_Srsx
Interpro
IPR009057   Homeobox-like_sf        + More
IPR012934   Znf_AD       
IPR001839   TGF-b_C       
IPR029034   Cystine-knot_cytokine       
IPR017948   TGFb_CS       
IPR015615   TGF-beta-rel       
IPR000859   CUB_dom       
IPR035914   Sperma_CUB_dom_sf       
IPR032171   COR       
IPR020859   ROC_dom       
IPR000719   Prot_kinase_dom       
IPR011047   Quinoprotein_ADH-like_supfam       
IPR011009   Kinase-like_dom_sf       
IPR008271   Ser/Thr_kinase_AS       
IPR027417   P-loop_NTPase       
IPR000757   GH16       
IPR013320   ConA-like_dom_sf       
IPR038717   Tc1-like_DDE_dom       
IPR001523   Paired_dom       
IPR036388   WH-like_DNA-bd_sf       
IPR005821   Ion_trans_dom       
IPR024862   TRPV       
IPR036906   ATPase_V1_fsu_sf       
IPR017452   GPCR_Rhodpsn_7TM       
IPR000276   GPCR_Rhodpsn       
IPR019424   7TM_GPCR_Srsx       
SUPFAM
SSF46689   SSF46689        + More
SSF57501   SSF57501       
SSF49854   SSF49854       
SSF56112   SSF56112       
SSF52540   SSF52540       
SSF50998   SSF50998       
SSF49899   SSF49899       
PDB
5CR4     E-value=0.00398215,     Score=88

Ontologies

Topology

Subcellular location
Secreted  
Length:
129
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02765
Exp number, first 60 AAs:
0.02765
Total prob of N-in:
0.56625
inside
1  -  129
 
 

Population Genetic Test Statistics

Pi
52.981515
Theta
55.001461
Tajima's D
-0.155246
CLR
0.058765
CSRT
0.333483325833708
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号