SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12022
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Full name
Retrovirus-related Pol polyprotein from transposon TNT 1-94      
Location in the cell
Nuclear   Reliability : 3.296
 

Sequence

CDS
ATGTCGACGTCGGGCTACCTAGTTAATGTGCCGAAACTCAAAGGTCGCGAAAATTACGATGATTGGGCGTTCGCAACAAGTAATTTTTTGCTGCTCGAAGGCATTGACTTGGAGAACCTTTCCGCAGAAATGAGTGAAGCTGAGATGAAAAAAGCCAAAGCCAAACTCGTCATGACTATTGACTCTTCATTATACGCGCATATCAAGAGTGAGACTACAGTAATCGGTGTATGGAATAAATTGAAACAATTGTTCGATGACACCGGGTATCAACGAAAAATCAGTTTGCTTCGAACGTTAATTTCAGTTCGCCTCGAAAACTGTGATTCGATGACAAGCTACGTATCTCAAATAGTTGAAACTGCGCAGAAATTGAAGGGCACAGGATTCGAAATCACAGATGAGTGGATTGGGTCATTACTTTTGGCGGGACTCTCAGATAAGTTTTCACCTATGATAATGGCGATCGAACATTCAGGAATCGCCATTAGCGCTGACGTCATTAAGACAAAATTGCTCGATATGTGTGAGGAGGTGGGTACTACTGAAAAAGATTCTGCATTTTGGTCAAAACAACAGCGGTGGAAAAGTGGAAACACTAACCGTGGTGTGAAATCGCAAACGTCAACGTCAAATAGTGACAGAAATGACAGTGCAAGTTCAAATGGCGGTAAACAAATAAAATGTTATAATTGCAAGAAAATAGGGCATTTTAAAAATAAATGTCCCGAACTAAAAACAAAGAAAACCTTAAATGCTTTTAGTGCTGCATTTTTTAACGGAAATTTTAGTACAAAAGACTGGTACGTCGATTCAGGTGCAAGTGCACACATGACGGCAAGTCGAGATTGTTTACAGTTAAATAGACCCGTGCATGAAAACAAAGAAATAGTAGTTGCAAATCAAATGACTGTGCCTGTTGTGAGTGTTGGTGAAACACAGATAACCACGATTGTAAATGGTTCTCAGTATGATGTCATTGTAAAGAATGTTTTATACATACCGAAGCTCACGACAAACTTATTATCGGTAAGTCAACTGATAGCAAATGGCAACAAAGTGTCATTTAAGAAGGATGTTTGTTTAATATATAATCCAGTAAATGAGCTTATAGGAATTGCAAACTTAACTAATGGTGTGTACAAACTACAAATACAAAGACCAGAGAGTGCATTATTGGCCATGACAATGTGGCATAGAAGACTAGGACATGTAAACAGTAAATCTTTAGAAATGATGAAAGAAGGTGCTGTGAAAGGGGTTACTTTTGATAAGAAAGCTGATATTCAGATCAAGAACTGTGAAGTGTGCTGTGAGGGCAAACAGGCTCGTTTCCCTTTCCCATCTGCTAATCATAGAAGTGATATACTACTAGACGTAATACACTCAGATTTATGTGGGCCGATGGAGACCAAATCAATTGGTCAAGCAAAGTACTTTCTTCTGTTCATAGATGATGCCAGCAGAATGACTTATGTCTATTTCTTGAAGGAAAAGAACCAAGTATTCCAGCATTTCAAAGAATTTCGTGTTTTGGTGGAGAATCAAACAGGAAACAAGATCAAAATATTGAGAACAGATAACGGAGGTGAGTTTTGTTCACAAGAGATGGAAGAGTTCTTAAAACAAACTGGAATCATCCATCAGAAGACTAATCCTCACACTCCACAACAGAATGGACTCTCAGAAAGGTTCAACAGAACTGTAGTTGAACGGGCTAGATGTTTACTGTTTGAATCAGATCTCGACAAAAGTTTTTGGGGTGAAGCAGTGAATACTGCAGTATACCTAATGAATAGAATACCAGCTGTCAGTCTAGGCATGATGACACCATATGAGAAGTGGACAGGCAAGAAGCCAGATTTGAGCTATGTCAGGATTTTTGGAAGTAAAGTAATGGTGCATGTTCCCAAAGTGCAAAGACAAAAATGGGATAAGAAGGCTGACAAATTAATTCTAGTTGGTTATCCGGATAACGTGAAAGGTTACAGATTATATAACCCCAAAACCAAGAAGATTACTACGAGCAGGGACGTCATTATAATAGAGAAAGAACACTCGGACACAGCTCAGGTAGTAGTAAATAATGAAAAAGTGTTGGAGAAAGTTGAAAATTCAGAGAAAGAGAGAAGCATATCAGAAAATTCAACTATAGACGCTAACGATCCTACATATATTTATGACTCATCGAGCTCCCACGAAGATTCATATCAATCGGTGTATGAAAGTGAAAATGAGTCAACCTTAGAATCCATTTTAGAAGAAAATATTCAAAACTTACAGGAGCTTGGTAAGCGCAAGAGAAAGCCAGTAGAAAGATATGGCTATTCCAATCTCTGCATTGTAGATGAGCTGGAATCCTGTGGTGAAGAACTGAGTTATGAAACAGCAATAAATGGACCAGAGAAGGAACTGTGGGAACAGGCGATGGCAGAAGAACTGAAGGCATTTGAAGAAAACCAAGCATGGGAATTTGTTGACAGAAAAGAAGCTGATAGGATAGTGCAATGTAAATGGGTTTTTAAGAAAAAGTTTGAATGTGATGGTAAAGTGCGTTATAGGGCTAGACTGGTAGCAAAAGGTTTTACTCAAAAAGAAGGTTAA
Protein
MSTSGYLVNVPKLKGRENYDDWAFATSNFLLLEGIDLENLSAEMSEAEMKKAKAKLVMTIDSSLYAHIKSETTVIGVWNKLKQLFDDTGYQRKISLLRTLISVRLENCDSMTSYVSQIVETAQKLKGTGFEITDEWIGSLLLAGLSDKFSPMIMAIEHSGIAISADVIKTKLLDMCEEVGTTEKDSAFWSKQQRWKSGNTNRGVKSQTSTSNSDRNDSASSNGGKQIKCYNCKKIGHFKNKCPELKTKKTLNAFSAAFFNGNFSTKDWYVDSGASAHMTASRDCLQLNRPVHENKEIVVANQMTVPVVSVGETQITTIVNGSQYDVIVKNVLYIPKLTTNLLSVSQLIANGNKVSFKKDVCLIYNPVNELIGIANLTNGVYKLQIQRPESALLAMTMWHRRLGHVNSKSLEMMKEGAVKGVTFDKKADIQIKNCEVCCEGKQARFPFPSANHRSDILLDVIHSDLCGPMETKSIGQAKYFLLFIDDASRMTYVYFLKEKNQVFQHFKEFRVLVENQTGNKIKILRTDNGGEFCSQEMEEFLKQTGIIHQKTNPHTPQQNGLSERFNRTVVERARCLLFESDLDKSFWGEAVNTAVYLMNRIPAVSLGMMTPYEKWTGKKPDLSYVRIFGSKVMVHVPKVQRQKWDKKADKLILVGYPDNVKGYRLYNPKTKKITTSRDVIIIEKEHSDTAQVVVNNEKVLEKVENSEKERSISENSTIDANDPTYIYDSSSSHEDSYQSVYESENESTLESILEENIQNLQELGKRKRKPVERYGYSNLCIVDELESCGEELSYETAINGPEKELWEQAMAEELKAFEENQAWEFVDRKEADRIVQCKWVFKKKFECDGKVRYRARLVAKGFTQKEG

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Aspartyl protease   Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Protease   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger  
Feature
chain  Retrovirus-related Pol polyprotein from transposon TNT 1-94
EMBL
AGBW02009826    OWR49812.1    GEZM01011856    JAV93393.1    GEZM01011857    JAV93390.1    + More
GEZM01011858    GEZM01011854    JAV93389.1    KQ460297    KPJ16236.1    LBMM01004924    KMQ91985.1    NWSH01002292    PCG68657.1    PCG68658.1    GEZM01011855    JAV93396.1    NWSH01000816    PCG74073.1    KQ459875    KPJ19636.1    JXUM01099713    KQ564513    KXJ72145.1    GEZM01011859    JAV93384.1    GEHC01000991    JAV46654.1    GEHC01000990    JAV46655.1    GEZM01045162    JAV77889.1    GBHO01003630    JAG39974.1    GBXI01011094    JAD03198.1    KL367628    KFD61291.1    GFTR01008662    JAW07764.1    GBHO01020706    JAG22898.1    GANO01000510    JAB59361.1    GEHC01000988    JAV46657.1    GEHC01000989    JAV46656.1    GBHO01033237    JAG10367.1    KL367553    KFD64618.1    GAKP01015352    JAC43600.1    GBHO01026221    JAG17383.1    GBHO01033235    JAG10369.1    JYDJ01000808    KRX33413.1    JYDT01000069    KRY86576.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    JYDH01000330    KRY26802.1    JYDJ01000136    KRX42725.1    JYDR01000001    KRY80095.1    GANO01000659    JAB59212.1    GANO01000660    JAB59211.1    GEHC01000867    JAV46778.1    GEHC01000868    JAV46777.1    NEVH01019375    PNF22597.1    NEVH01002725    PNF41351.1    NEVH01006980    PNF36330.1    NEVH01006721    PNF37230.1    GEDC01002834    JAS34464.1    JYDQ01000379    KRY07987.1    DNYX01000353    HBK84078.1    LBMM01008124    KMQ89126.1    GBHO01026200    JAG17404.1    GBHO01036544    JAG07060.1    KQ460882    KPJ11482.1    GEZM01045163    JAV77888.1    GBHO01011746    GBHO01011744    GBHO01011742    JAG31858.1    JAG31860.1    JAG31862.1    GDHC01012180    JAQ06449.1    GAMC01020352    JAB86203.1    GFTR01008771    JAW07655.1    GDHF01030254    JAI22060.1    KA648745    AFP63374.1    CM003608    KYP66486.1    JYDK01000071    KRX78146.1    GAMC01019995    JAB86560.1    JYDN01000113    KRX56900.1    GDHF01029191    JAI23123.1    JYDU01000001    KRY01876.1    GBXI01002679    JAD11613.1    GAMC01019998    JAB86557.1    JYDM01000185    KRZ84108.1    JYDL01000068    KRX18751.1    GBHO01016859    JAG26745.1    GBHO01043059    JAG00545.1    LBMM01008884    KMQ88558.1    LVZM01023578    OUC39908.1    KRX78123.1    JYDJ01000518    KRX34768.1    LBMM01012464    KMQ86211.1    GAMC01018156    JAB88399.1    KQ483843    KYP40338.1    JYDP01000350    KRZ01021.1    KRY26801.1    GAMC01018157    JAB88398.1    GAMC01018154    JAB88401.1    CM007901    OTG04806.1    GEHC01000927    JAV46718.1    LBMM01012368    KMQ86259.1    JYDH01000361    KRY26687.1    KQ460208    KPJ16606.1    KYP40337.1    X13777    OIVN01000260    SPC77257.1    GAMC01019997    JAB86558.1    AF279585    AAK29467.1   
Pfam
PF13976   gag_pre-integrs        + More
PF00098   zf-CCHC
PF00665   rve
PF07727   RVT_2
PF13961   DUF4219
PF14244   Retrotran_gag_3
PF13696   zf-CCHC_2
Interpro
IPR025724   GAG-pre-integrase_dom        + More
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR025314   DUF4219       
IPR029472   Copia-like_N       
IPR025829   Zn_knuckle_CX2CX3GHX4C       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
1C1A     E-value=0.000217172,     Score=109

Ontologies

Topology

Length:
867
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00590999999999999
Exp number, first 60 AAs:
0.00106
Total prob of N-in:
0.00024
outside
1  -  867
 
 

Population Genetic Test Statistics

Pi
361.589426
Theta
112.68889
Tajima's D
-1.299132
CLR
0.035528
CSRT
0.087995600219989
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号