SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12013
Annotation
PREDICTED:_craniofacial_development_protein_2-like_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.451
 

Sequence

CDS
ATGGAAGAAATTTTGATTGCGCTCAAAGAAATAAAGAAAGACCTGGACGAGCAGAGACAAGAAATCCGAGCAACTGGAATTAATGTTACGGATAAAGTATCAAAAAATGTAAACAAAATGCTCGAAGAAAAATTCCTAGTATGGGAAAAAAAACTAAAGCACTGCGACATACAAGAAGTCAGGAGAGTGGGAAAGAAAGAGGAACGACCACGCCCTATAGTAGTGACCTTCACAACACTAGGTACTAAAATTAAAAGCTGGAAACGAAGAAATACACTAAAAGATACCTATTTCTACATGAAAGAAGATTACCCGAAGTACGTGCTAGAAAAGAGGAAGGGCTTACAAGAGCAGCTACGTATAGAAAGAGAGAAGGGAAATACAGCGTTATTGAAGTATGATAAATTGATCATCCTGCCCAAAACCAATACGAAAAGAAAATTACCCACCTCACCAAACAGCGGCACAACTTCAAAAGTAAACGAGACCTCACAAATAAACAAGAAGAACAAGATTCAAAAACCTGGTACCCCCGTGATAAGATCCAACAGCATCTCCGAGGGAGTTGTTAAACCAGGCATGCTGAACTTCTTGCAATTGCCACCCTCCTCCAATTCAAATTCAAATTTAGTACTTAAGAACAATCAAACTAAACATCTTCCAAAACGGCTGGTCACCGAGGAAGATTACGACTACAACCCTCCAAGTGTAAACATTAACAGACAGCTTATAAGTAAAACAAATAAAGATAATGAACAAAAACTTTATATAATAACTTTCAACGTGAAAACACTATCTTCTTATGAAAAACTAATAGAATTAACAGAATCACTAAAATCAATAAAAACAGACATTATTGGAATGTCAGAAGTGAGACGTCTTGGGGAAAAAATAGAGGAATATGAGGATTTTATTCTTTACTACATGGGCCAGACACCTGGACAGTTCGGCGTGGGCTTTTTGGTGAGAAAAAATCTTAAAGTAAACATAGAGAACTTCACGGGCTTATCAGAACGAGTCGCTATATTAAACTTACAATTCCATGGGCAAAAACTATCAATCATTCAAGTCTACGCACCCACAGAAGCAGCAAATGAAGAAGATATTTCTTATTTTTATGAGACAGTCAGAAAGGCTAGGGAGTTAGCGCATAAATACTATATCATAATGGGCGACTTCAATGCTAAGATAGGTAAACCAAGACACGAAGAATTCTTGGTTACAAAACCATTTGGTCTTGGTATAAGAAATGACAGAGGCCAAAAATTGATGGATTTCGCTTTAGAAACTAAGACGGCAATAATGAACACATACTATCATAAGAAACCAAACCGCAGATGGACATGGCGCTCACCAGGTGGCGCATATAAAAATGAGATCGATTACATTCTATCTAACATACCGCAGAAGTTTCATAATGTGGAAGTTCTAAATATCAACTACCCATCAGACCACAGGCCAGTGAGAGCAACCATATCTCTTGAAAAAATAAAAATATCCAGGACTAGATACAAGACCAACCAGTGTGCGAGTCTAAAATACGAAAGCGAAATACTCAGATTCAGATTAAATCTCCAACTCCACCTGCTACGTGCCGATGACCAGAACTTGAAAGATACTGATAATATACAGACTCAATACAACAAAATAACCAATGCCATCTCGAGAAGCCTAGAAGAAACGCACAAGGAACACAATTCGTACAGACACAAAAAAATATCGCTACGCACAGAAAAACTCATGACTAGAAGGAAAGAATTACAGAAGACTAAAAACAAAACCAGAAGTATAAGAAACGAAATATCAGCTTTATACAAACTCATTAGCAAGTATATCAGGCAAGATTATGCAAAATACAGACAGGATACCATAACTAAGCACTTACAAGTTTCAGGCAGCACAAAAAAGGCTTATAAAGAGCTAGCACAAAATAAAACTTGGATCGAAGGACTTAAATCATCAGGAAAACAATCTATAATAACAAACCGCAATGATATCATTAATATGGCCACTGAATTTTATAAATCATTATACAGTAAAAAAACATCCACATATGTAGACATAACACCAAGCAGTAATATATCAAACAACGAAAAGGTGCAACCAATCACGGAATCTGAACTTATTACAGCAATAAAAAACCTGAAAACCGACAAAAGCCCAGGCCCAGATGGCATAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATCTGTGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCAAGACTCCGCGAGGAGTGCGTGAGGGCGCGCCGCCTGCCCTGGTGCGCAGGCGTGGCACACGTCGTCACTAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGATGTTTCACGGGCCGGGACGAGCGCCGCCTGTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACTTTGAGAAGTTGGGCCCTCGGCTGATGGCAACGGCCGGCTCTTTGAGCCGGCTCCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCAGCGAAGGTGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACCTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCTGACCGCGACGAGGATGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGGCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTTGATTCGCTAGAGAAAAATCAACCAATTGAACAAGCAGGATTCAGAAAAGGTTTTTCTACAGTGGACCACATTCACACCTTAGAACTCTTGATAGAAAAATACCAAGAAAAACAGAGAACACTATACATTGCATACATAGACTACCAAAAGGCTTTTGACACTGTGTCACATGATAGTGTATGGAAGTCGTTAAAAAACCAAGGGGTGAATGATAAATATATACAGATAATTAAAAACATTTATAAAACTAATACAAGTAGAATAAAACTAGAATCTATAGGCCCAAGATTTTCTATCAAAAGAGGTGTAAGACAGGGAGACCCCATGTCTCCAAAAATTTTCATTGCCATACTTGAATCAATATTTAGACAGCTAGATTGGAAAAACCTCGGCTTAAATATTGAAGGTAAATATTTGACTCATCTCCGCTTTGCAGACGACTTAGTAGTGCTGGCAGAATCAAGTTCAGAACTTCAATACATGGTTGAGTCTCTCCACAGAGCCAGCATTAAAGTAGGCTTAGAAATGAATACAACAAAAACGTTGGTAATGACAAATAGTGCTAGAAAGAAAATAACAGTCGGAAACGAACTATTGAAATACACAGACCACTATATTTACTTAGGAAAACAGATCAGCTTTGAAAGAAAAAGCAATGAGATGGAGATTGGAAGAAGAATCCAACACACCTGGAACAAGTACTGGAATTTACGTGAAGTATTTAAAAGTACGTTGCCAATATACTTAAAAACCAAGGTTCTAAATTCCTGCATTCTACCATGCTTGACTTATGGCTGCCAAACTTGGAAGTTTACATCAAAGGCCAATAATCTAATAGTAAGCTGCCAACGAGGAATGGAGCGAAGTCTGCTGAATATAAGAAAGATTCAAAAAATCAGACACACAAAAATCAGAGAAAAAACAAAATCTATAGATGCTCTTGAATATGCCAGAAACTTAAAGTGGAAGTGGGCTGGTCATGTAGCCAGACTTAAGGACCAGAGATGGACTGCAAGAATAACTGCATGGGAAGGGCCACAAGGGAAAAGAAAAAAGGGTCGCCCGATATCAAAATGGGAGGATGATATAAAAGCTATCGCTGGCCCTCGATGGATACAGGTAGCCCAAAATAGAACCAAATGGAAGGACTTGGAGGAGGCCTTCACCATGTTTAATGGGTTCCTGCCAAACATAAGTGAAGAAAATTAA
Protein
MEEILIALKEIKKDLDEQRQEIRATGINVTDKVSKNVNKMLEEKFLVWEKKLKHCDIQEVRRVGKKEERPRPIVVTFTTLGTKIKSWKRRNTLKDTYFYMKEDYPKYVLEKRKGLQEQLRIEREKGNTALLKYDKLIILPKTNTKRKLPTSPNSGTTSKVNETSQINKKNKIQKPGTPVIRSNSISEGVVKPGMLNFLQLPPSSNSNSNLVLKNNQTKHLPKRLVTEEDYDYNPPSVNINRQLISKTNKDNEQKLYIITFNVKTLSSYEKLIELTESLKSIKTDIIGMSEVRRLGEKIEEYEDFILYYMGQTPGQFGVGFLVRKNLKVNIENFTGLSERVAILNLQFHGQKLSIIQVYAPTEAANEEDISYFYETVRKARELAHKYYIIMGDFNAKIGKPRHEEFLVTKPFGLGIRNDRGQKLMDFALETKTAIMNTYYHKKPNRRWTWRSPGGAYKNEIDYILSNIPQKFHNVEVLNINYPSDHRPVRATISLEKIKISRTRYKTNQCASLKYESEILRFRLNLQLHLLRADDQNLKDTDNIQTQYNKITNAISRSLEETHKEHNSYRHKKISLRTEKLMTRRKELQKTKNKTRSIRNEISALYKLISKYIRQDYAKYRQDTITKHLQVSGSTKKAYKELAQNKTWIEGLKSSGKQSIITNRNDIINMATEFYKSLYSKKTSTYVDITPSSNISNNEKVQPITESELITAIKNLKTDKSPGPDGIKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRLPWCAGVAHVVTRIRRLGLEVALDKTQALMFHGPGRAPPVGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPSEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEDDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCEATISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPLDSLEKNQPIEQAGFRKGFSTVDHIHTLELLIEKYQEKQRTLYIAYIDYQKAFDTVSHDSVWKSLKNQGVNDKYIQIIKNIYKTNTSRIKLESIGPRFSIKRGVRQGDPMSPKIFIAILESIFRQLDWKNLGLNIEGKYLTHLRFADDLVVLAESSSELQYMVESLHRASIKVGLEMNTTKTLVMTNSARKKITVGNELLKYTDHYIYLGKQISFERKSNEMEIGRRIQHTWNKYWNLREVFKSTLPIYLKTKVLNSCILPCLTYGCQTWKFTSKANNLIVSCQRGMERSLLNIRKIQKIRHTKIREKTKSIDALEYARNLKWKWAGHVARLKDQRWTARITAWEGPQGKRKKGRPISKWEDDIKAIAGPRWIQVAQNRTKWKDLEEAFTMFNGFLPNISEEN

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00886568,     Score=98

Ontologies

GO

Topology

Length:
1561
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0668700000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1561
 
 

Population Genetic Test Statistics

Pi
256.082463
Theta
41.235209
Tajima's D
4.363516
CLR
0.960008
CSRT
0.999750012499375
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号