SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11982
Pre Gene Modal
BGIBMGA010729
Annotation
hypothetical_protein_AB894_15365?_partial_[Piscirickettsia_salmonis_LF-89_%3D_ATCC_VR-1361]
Location in the cell
Nuclear   Reliability : 2.961
 

Sequence

CDS
ATGTCAAAGTCAAGTACAGGTAGAGGTAAAAATAATAAAACACGTGAACGTTCTCCGAATCCTGGACTGTACCAACAACTTCAAGCGATTGTATCTCGCCTGAATGCGTTGGAAGACAATTCAAGGTCTGGTATAGCGACTGTTGTTGAGAGGCAGCCTGCGGTGGAGTCATCGGGATCGGCGGGCAGTGCTGTGGTGCCGTGCGTGGTTCTGGCTTCTGAGCAAAGCACGACACCGCCATTGGTGCCTACGCCGGTTCCACGAGTTTCCGCTGACGATTGCGTCGCTGCCGAGGTAGCCGGTAAAATTGTAAGCGCAATTAATGAATTGAATCTGGTAAGGCCGAACCATATTTATATATCAAACTTTGATCCCGATTTAAATGACATTAATGTTTGGTGTGATGAAGTTGATCATGCACGTGTCATTTATAGGTGGACCGATAGGGAGTGCTTATCTCATATTGGTAATTGCCTTAAAGGCGATGCTCGTGTGTGGTTAAATGAATGGGTCACCAATGACCGTAGCTGGTCTAATTTTAAACGCGAGTTTAAGCCGTTGTGTCCCCGTCGGGTAGATGTTGCAAATATCCTTTTTGATGTTATGAAAACCGATTCCAACAACTATCCTACATACGCGGAATATGTTAGGCGATCTTTATTGCGTCTTCGTATAGTAAATGGACTTAGTGACGAATTAGTTTCAGCAATAGTGATCCGAGGTATCGTTGATCCACAAATTCGTGCGGCCGCTACAAACGCGAGGTTATTGCCTAACGATTTAGTTGAGTTTTTCTCCATATATGTAAAGCCTACACCTCAAACAAAAACAAATCATAATACTCGCACTGTAGCTGGTCGCTTTCATAATACACAATTCTCATCACGTAAAAGAGAGCATAGTTCTAGTAGAACCGGTTGTTACGTATGTGGATCATTTGGCCATAGACAAGTGAATTGCCCTAAGCGAACGAGAAAACGTTCGCCTACTGTGAATGATAGATTCACATCTGTACCCGCTGCCAGCTCCTCTGTGCAGAAGCCTGAACCTTGTTCTTTTTGTAAAAAGCTGGGCCATAAAGTAGAGCAGTGTTTCTTTAAGCAGCGTTCTGAAGCTCGAGGAAAATCTAACGTGAATTTTTGCCGTGATACTGTAAATGACTATAGAAAAAATGATATAGCTACTGCGATCGTACAGGGTGTACCAGTCGATATCCTGATAGATAGTGGATCCACAGTCTCGCTTATGTCTGAATCAATTGTAAAACATTTTCAATGTAAACGAGTACCCTCATTTTGCGTGTTACGAGGAATTGGTGACTGTGATACTGAATCTCGCTATTTTACTACTTTGACAGTTGAGTTTCCCGAAATCACACTAGAAATAGACTTTCAAATTGTTAGTGACAAGTTCATGAATACTCCAGTCATAATCGGTACTGACGTTTTGAATCGGGAAGGTGTCACGTATATTAGGAAAAAGGGCATACAGCGCTTAACTCGGGTAGAAAAGGTTTTTACTGCTGAGACAACTGAACTTAATTCAATCCCTACCGTGAATACTTCATTAACAGGTGAAGAAAAAAATAAATTATTAGCTTTGGTACGAAAATTTTCAAAATACCTTATAACTGGTACCGCGGCCAGTACTGTTACAACTGGATCCATGCAAATTCGACTCAGCAATGAAACTCCTATTGTTTACAGACCTTACAAATTATCATTTAGCGAAAAACTTCGCGTTAGAGAAATTATTAAAGATCTTCTTGATAAAGGTGTGATTAGGGAGTCTGAATCGGAGTTCTCGAGTCCGATATTGCTAGTTAAGAAAAAGGACGGCAGTGACAGGATGTGCGTGGACTTTCGGGCTCTTAATGCGAATACTGTGAAGGATCGCTATCCATTGCCGTTAATAGACGATCACATTGACCGGTTAGGTAGCGCAAAATATTTTACAAGCCTCGATATGGCCACTGGTTTCCACCAGATTCCTTTAGCAAACGACTCCATTCACAAAACCGGTTTTGTGACACCCGAAGGTCATTTTGAATACCTTAAAATGCCCTACGGGTTAGCCAATGCCCCGGTTGTTTATCAACGTATTATAACTAATACTCTGAAAGCCTTTAGTGAGACAGGGAGGGCTTTAATCTATATCGATGATGTTTTAATACCTAGTCAGACCATTGATGAAGGCCTAAATACTCTGCGTGAAATCTTTGAAACACTAACTAAGGCGGGCTTCTCAATTAATTTAAAAAAATGCAAGTTTCTTGCTAACGAAATTGAATATTTGGGCAGAACTATCAGCAATGGTCAGGTTAGGCCGAGTGCGTATAAAGTAGAAGCATTGACAAGAGCCCCGAAGCCTGGTAATGTTAAACAAGCTAGACAATTTTTAGGTCTAGCGGGTTATTTTCGGCGCTATATTCCTGCATATTCGTTGCAGACAGCTTGTATTTCTAATCTGTTTCGTAAAGGTGTTGAGTTTAAATGGGGTGATGAACAGGAACAAGTACGCCAGTATATAATTACGCGTTTAACCAGTGAACCTGTCCTCAATATATTTAATCCATCATTATTAACAGAAGTACACACTGATGCTTCTTCTCGAGGGTATGGAGCTGTTTTACTTCAGACTCATGGGAATAATAATAAACGCGTGGTGGGATATTTTAGTAAAGTTACCCAAGGCGCCGAACCACGCTATCACTCCTATGAGCTGGAGACACTCGCTGTGGTCAAGGCTCTGCAGCATTTCAGGCACTACCTCATAGGTATACATTTCAAGGTAGTTACAGACTGCAACGCTTTGAAGCTTACCCAACGTAAAAAAGATTTACTACCGAGAGTCGCTCGGTGGTGGATCTACTTACAAGATTATGATTTTTCGTTAGAGTATCGTAAGGGCGCTGTGCTATCTCATGCCGACTATCTAAGTCGTAATCCTATAAATGTTTGTGAAATTGGTAGACCGCATAACTGGGCACAGATAGCACAGAGTGCTGATGAAGAAACTCGGAATTTAATACAAAAGTTACAAAACGGTGAATTAGATGAGACACGCTATGTAACTAAAAATGATGTTCTTTATTATAAATTTGATTCTGTTGGCCAACCTAGTAAATTATTATGTTATATTCCAAGAGGACATCGCCTCAGTTTGTTACGAATCTTTCATGATGAGCATCATCATATTGGAGTAGATAAGACGCTTGATCTAATATTAAACCATTTTTGGTTTCCTAGTCTAAGACAATTTGTTCGTAAATATGTACGCCATTGTATAGTATGTCTTTCACACAAAAAAATACCACGTCAACCCTTGCAGCCGATCGAGTCGTGGAAGAAACCGGACGTACCCTTTGACACGGTACATAGTGATGTCTTGGGTCCTCTTCCCGAATCGAACGGTTACAAATTTGTTGTCTTGATAATTGACGCTTATAGTAAGTTCTGTCTACTAAATCCTATGCGTAAGCAGGATGCAACAGAGTTAAAATTAGTATTTGAAAACGCTGTATCTTTATTTGGTGCACCTAGGCAGATTGTAACCGATAGGGGTAGAATGTACGAAAATAGATCATTTAGACAATGGGTATCAGACGTAGGTAGTAATTTATTCTTTATAACGCCAGAGATGCACCAGAGTAACGGTCAGGCTGAGAGATATTGCAGAACAGTTCTTAATATGATTCGTGTGGAGGTAAATTTCAGAAACGAAAATTGGTCAGAAGTTTTGTGGAAACTGCAGCTCACCCTGAACGTTACGAAACAAAAGTCCACTCAATATTCACCTTTATATTTGTTAATTGGTAGCGATGCTGTGACGCCCGTCATTCGTTCCGTTGTACGCGATGTGGCTCTAGAAGGAACAAGTGCCAACAGAGAAACCTTACGCGAGCTTGCCCGACAAAGAGCTTCTCAACTGCTGGACAAAAACCGAAAACAGCAGGACACTCGAGTAAATGAACGGCGCAAACCCCCGCGTACTTTCCATGAAAACGACGTGGTCTTCGTGCATAAGAATAGCCAGTCTGTTGGAAAGCTGGATTCTGGTATGCGTGGCCCGTACAAAATAGTGCGTGCGCTGCCACATGGACGTTATGAACTGAAGCTTCTTTCTGGCTCACTTGGGAAGACCACGGAAGCTGCTGCCGAATTTATAAGTGCCTGGCACGGAGAGTGGACGCCGGATGTGTGCACCGCATTTTTCGAGTGTGATGAGAATAGCTCTGAGGAAGGTATTGTCGCCGGTCCATCACACCGCCATGACGACATAGTACCTCTAGACGGACCTATTAATGCGGGCGAGGACGCTCCGCCGTCAGGAGAGGCCGTGTTAGAAGATGATGATGACATTGGAGGCGTGGCCTAA
Protein
MSKSSTGRGKNNKTRERSPNPGLYQQLQAIVSRLNALEDNSRSGIATVVERQPAVESSGSAGSAVVPCVVLASEQSTTPPLVPTPVPRVSADDCVAAEVAGKIVSAINELNLVRPNHIYISNFDPDLNDINVWCDEVDHARVIYRWTDRECLSHIGNCLKGDARVWLNEWVTNDRSWSNFKREFKPLCPRRVDVANILFDVMKTDSNNYPTYAEYVRRSLLRLRIVNGLSDELVSAIVIRGIVDPQIRAAATNARLLPNDLVEFFSIYVKPTPQTKTNHNTRTVAGRFHNTQFSSRKREHSSSRTGCYVCGSFGHRQVNCPKRTRKRSPTVNDRFTSVPAASSSVQKPEPCSFCKKLGHKVEQCFFKQRSEARGKSNVNFCRDTVNDYRKNDIATAIVQGVPVDILIDSGSTVSLMSESIVKHFQCKRVPSFCVLRGIGDCDTESRYFTTLTVEFPEITLEIDFQIVSDKFMNTPVIIGTDVLNREGVTYIRKKGIQRLTRVEKVFTAETTELNSIPTVNTSLTGEEKNKLLALVRKFSKYLITGTAASTVTTGSMQIRLSNETPIVYRPYKLSFSEKLRVREIIKDLLDKGVIRESESEFSSPILLVKKKDGSDRMCVDFRALNANTVKDRYPLPLIDDHIDRLGSAKYFTSLDMATGFHQIPLANDSIHKTGFVTPEGHFEYLKMPYGLANAPVVYQRIITNTLKAFSETGRALIYIDDVLIPSQTIDEGLNTLREIFETLTKAGFSINLKKCKFLANEIEYLGRTISNGQVRPSAYKVEALTRAPKPGNVKQARQFLGLAGYFRRYIPAYSLQTACISNLFRKGVEFKWGDEQEQVRQYIITRLTSEPVLNIFNPSLLTEVHTDASSRGYGAVLLQTHGNNNKRVVGYFSKVTQGAEPRYHSYELETLAVVKALQHFRHYLIGIHFKVVTDCNALKLTQRKKDLLPRVARWWIYLQDYDFSLEYRKGAVLSHADYLSRNPINVCEIGRPHNWAQIAQSADEETRNLIQKLQNGELDETRYVTKNDVLYYKFDSVGQPSKLLCYIPRGHRLSLLRIFHDEHHHIGVDKTLDLILNHFWFPSLRQFVRKYVRHCIVCLSHKKIPRQPLQPIESWKKPDVPFDTVHSDVLGPLPESNGYKFVVLIIDAYSKFCLLNPMRKQDATELKLVFENAVSLFGAPRQIVTDRGRMYENRSFRQWVSDVGSNLFFITPEMHQSNGQAERYCRTVLNMIRVEVNFRNENWSEVLWKLQLTLNVTKQKSTQYSPLYLLIGSDAVTPVIRSVVRDVALEGTSANRETLRELARQRASQLLDKNRKQQDTRVNERRKPPRTFHENDVVFVHKNSQSVGKLDSGMRGPYKIVRALPHGRYELKLLSGSLGKTTEAAAEFISAWHGEWTPDVCTAFFECDENSSEEGIVAGPSHRHDDIVPLDGPINAGEDAPPSGEAVLEDDDDIGGVA

Summary

EMBL
GBHO01030786    JAG12818.1    GDHC01004980    JAQ13649.1    EF710649    ACE75273.1    + More
LBMM01008871    KMQ88569.1    GBHO01036023    GBHO01032007    JAG07581.1    JAG11597.1    LBMM01010976    KMQ87102.1    LBMM01005919    KMQ91096.1    ABLF02008401    ABLF02008404    KMQ91095.1    ABLF02033943    ABLF02042737    LBMM01011782    KMQ86633.1    ABLF02004401    ABLF02013544    ABLF02013550    GEZM01033083    JAV84424.1    GGMR01003388    MBY16007.1    GBBI01004477    JAC14235.1    GFXV01005120    MBW16925.1    X14037    CAA32198.1    GGMR01016004    MBY28623.1    GAMC01007326    JAB99229.1    ABLF02041876    GFTR01008753    JAW07673.1    ABLF02005846    GAMC01015907    JAB90648.1    GEHC01000888    JAV46757.1    GBBI01004551    JAC14161.1    GBXI01005773    JAD08519.1    GGMR01005091    MBY17710.1    GBBI01004550    JAC14162.1    KA649989    AFP64618.1    ABLF02003120    ABLF02004015    ABLF02057179    ABLF02066208    ABLF02014660    ABLF02042774    GAKP01014483    JAC44469.1    GBXI01004632    JAD09660.1    GGMR01015682    MBY28301.1    GEHC01000930    JAV46715.1    GAKP01016237    JAC42715.1    ABLF02017401    GEHC01000876    JAV46769.1    GAMC01020207    JAB86348.1    GAKP01016235    JAC42717.1    GBBI01004549    JAC14163.1    GBXI01015151    JAC99140.1    GBBI01004613    JAC14099.1    GEHC01000880    JAV46765.1    GAKP01019383    JAC39569.1    GGFK01005990    MBW39311.1    GGFL01001689    MBW65867.1   
Pfam
PF00078   RVT_1        + More
PF00665   rve
PF00077   RVP
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF00098   zf-CCHC
PF02037   SAP
PF17917   RT_RNaseH
PF13873   Myb_DNA-bind_5
PF03732   Retrotrans_gag
PF16064   DUF4806
PF09668   Asp_protease
PF12384   Peptidase_A2B
Interpro
IPR001878   Znf_CCHC        + More
IPR012337   RNaseH-like_sf       
IPR001969   Aspartic_peptidase_AS       
IPR001584   Integrase_cat-core       
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR000477   RT_dom       
IPR018061   Retropepsins       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036875   Znf_CCHC_sf       
IPR036361   SAP_dom_sf       
IPR003034   SAP_dom       
IPR041373   RT_RNaseH       
IPR028002   Myb_DNA-bind_5       
IPR005162   Retrotrans_gag_dom       
IPR032071   DUF4806       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR024650   Peptidase_A2B       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF68906   SSF68906       
Gene 3D
PDB
4OL8     E-value=3.64685e-77,     Score=739

Ontologies

Topology

Length:
1458
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00949999999999997
Exp number, first 60 AAs:
0.00032
Total prob of N-in:
0.00039
outside
1  -  1458
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
131.419742
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号