SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11978
Annotation
ORF_B_(bases_1850-5560)_first_start_codon_at_2306_[Autographa_californica_nucleopolyhedrovirus]
Location in the cell
Nuclear   Reliability : 3.187
 

Sequence

CDS
ATGGCCGTAGACCCGGACCAAATCTACAAGGCCCTTCGCCCAGTGCCAGAGTTCGACGGCAATCCGAACATACTGACTAGGTTTATCAGAATTTGTGACCAAATCGTCACGCAGTATATAAGAACAGATCCTGGAAACGAATTAAATAACCTCAGCTTAATAAACGGTATATTAAATAAAATAACTGGTCCTGCCGCCAGGACCATAAATTCAAATGGCATACCAGAGAACTGGTTAGGTATCCGTACTGCCCTCATTAATAATTTTTCAGACCAAAGAGATGAGACCGCTTTGTACAATGACCTCTCCTTACTAACACAGGGAAACAGTAGCCCCCAGGAGTTTTACGACAAATGCCAGACCCTATTCAGCACTCTCATGACATACGTAACTTTACACGAAAGCATTGCCACAACCATCGAGGCAAAACGCGACCTGTATAAAAAGCTAACAATGCAAGCATTTGTTCGAGGCCTCAAGGAACCCTTGGGATCTCGCATACGCTGCATGAGACCGACCTCCATTGAAAAGGCTCTGGAATTTGTACAGGAAGAACTTAACATAATGTATCTACAACAGCGAAACGGGTTCACCTCTGAACGGCGCAACCTTATTCAGCCTACACCGACACCACCTGTAAAAATACCACATATGTTTCCGGTAGCAATGCCGAAACCGCTTTCATTCGGACCGAACCCAGGACCGAGCTGGGAGCGACAGCCACCACCAGGACCTAATAACCACTGGAAACCTGCTTTCAAATTTAACGCCCCTCGGCGCATGCCTAACATGCCATCACGCACGCAGCAAATGTTCGCATCGCACCCACCAAACTACAACCCCCGTAGCAACGTATTTAGGCTACCTCAGCGGAACCAGGGACCGAAACCTATGAGTGGTATTAGTCACTACGTGGCAAAACAACTTCCACTCACAGGTCATGATTGGACTTTTTCAGAACTTAACGACGCGGGACCTATTAAACTGTTTGTCTACGATTTCCACAAATTTTTTGACGGACTTATTGGTTTAGACTTGCTGACTAAATGGAAATCTAGAATCGACCTTAAAGACAACCTACTGATTACAGACAATTCTACCAACCCTATTGAAATGTTCAATTCTCGCAACGTCAACCTGTACGAAGACATCGTACCGGCTAACTCTAGTAAACTAGTTAGAATTCCAATAAATTCATCTGACGGCGAAGTCTATATCCCGCAGCAATACCTGAACAACTGTGTGGTGAACGAATGCATCACGACAGTCGTTAAAAACCGTGTGGTCGGAGACATCAAAAAACGACCCGTTGTCAGTAAGCCATTTGAAACGCACACTCGCATATCCATACAAGTTTCCCAATCAAACTTAAGAGAAGACGTCATAAACGCCATTAAAGAATTCGTTAATCCTAAAGTAAAAACTGGCCTCCTTATTAATCCAACATTAAGCATGTACGACATTATACCTATAATACAAGACACGTTCAGAAATTCGGCAATGAATCTCTTACTCACAAAAGTCGAATTAGAAAATGTGAAAGAGTACCTTCGGCAACAAGAAATAATAAGCCACTATCACGATGGAAAAACTAACCACCGCGGAATAAATGAGTGTTATTTAGCTCTTTCGCGAAAATATTACTGGCCGAAAATGAAAGATCAAATTACAAAATTCATAAACGAATGTACTATATGCGGACAAGCTAAATACGATCGCGCACCCATTAAACAGCAGTTTAGCATAGTACCACCCCCGAAGAAACCCTTCGAAATAGTTCATATGGACTTGTTCACCGCCCAATCCGAAAAATACCTGACATTTATTGACGTATTCTCTAAGTACGGACAGGCTTACCTGTTGAGAGACGGCACAGCAATTAGCGTATTACAGGGTCTATTGCAGTTCTGCACGCATCATGGTCTACCTTTAACGATAGTAACTGATAATGGTACAGAATTCACAAACCAATTGTTTTCCGAATTCATACGACTTCACAAAATAAATCATCATAAAACCCTAGCACATACACCTAATGACAATGGCAATGTAGAGAGATTCCATTCAACCTTGCTAGAACACCTTCGCATACTTCGCTTACAACATAAAAATGAACCTGTAATAAACTTAATGCCTTATGCAATATTAGCTTACAACAGTTCAGTCCATAGTTTCACCAAATGTCGCCCTTTTGACATAATAACGGGACACTTTGACCCTAGAGACCCTCTCGACATTGACATAACAGCCCATTTACTGCAACAGTACATGGAATCACATAAAGCTCAAATGACTACAGTTTATGAACTCATAAATGAAACCTCACTTGCTAACCGTACATCGCTCATTGAAAATAGAAATAAGAACCGCGAACCAGAAGCGACGTACCAACCTAACCAACAAGTTTTCATTAAAAACCCGATAGCAGCCCGACAAAAAACAGCCCCGAGGATTCTACTGAACCTCCTGACCCGACATCTGACGACCGCACACGAGATAAAACTTGAGACCCTCGAGAACGGACCTGGACTTTTACCTTTTAAACTCGGACAGACTAGACTCGTATCCCACTATCATTCATTTTTACAATATATAGAATTAGCTGACCATCAATTAACTTTCATCCCTCCTTATCCTTTCATCGCAACAAATAAGAAAGCGTTCATGTACATAGAGGCTGAATGCCCGAAGTACAACAGGTACTACCTCTGCGAGGAAAATATAAATCACCAGCCAAGAGATGATCCTGATTGCATCCACGATCTTATCTACAATCAAGCCATGAACACCTCATGCCAGCCAACCTCTGTTTCTTTCACTAAAGAAGCCATGGAACAACTAGACGATAAGCATTACGTCCTTATTTTCCCCGAGACCACGAAGATCGAACTTCATTGTCAACGCCTGGAGTACAGTACGCTTCAAGGAAGTTATCTCGTTACCATTCCGCAAAATTGTAAGCTGCGAACCGGACGACTAACACTGGCAAACAATAATGATCAGATCAACGGACAGCCTCTGAAAATAACTGAAATCCCGAAGGATGCAAAAATCACAGGACCCATTAGACCTCATATCAAGCTCACCTCCTTGAACCTGGAGAAAATACACCAAATCCAGGATGATATAATCCAACAACATCCTGTGGACCTAGAACAAAGTGACGTCACGAACCAAGCACTCTTTCATACGACAATACCTTTTTACGGAGCACTCTGCGGCGCGATTGTCCTAGCTGTTGTAATCGCTGTTCATCGGCACAAGTCTTGCAACATAACCCTGGAAAAGAAGCCACGCGAAGAAACCTCAAAATTTCACCCGTACGAGAGTCCAGAAGAACCCCAGAAGAAGGACCGAATTCCGGCAACATTTGCCCTCAAGATTATCAAATAG
Protein
MAVDPDQIYKALRPVPEFDGNPNILTRFIRICDQIVTQYIRTDPGNELNNLSLINGILNKITGPAARTINSNGIPENWLGIRTALINNFSDQRDETALYNDLSLLTQGNSSPQEFYDKCQTLFSTLMTYVTLHESIATTIEAKRDLYKKLTMQAFVRGLKEPLGSRIRCMRPTSIEKALEFVQEELNIMYLQQRNGFTSERRNLIQPTPTPPVKIPHMFPVAMPKPLSFGPNPGPSWERQPPPGPNNHWKPAFKFNAPRRMPNMPSRTQQMFASHPPNYNPRSNVFRLPQRNQGPKPMSGISHYVAKQLPLTGHDWTFSELNDAGPIKLFVYDFHKFFDGLIGLDLLTKWKSRIDLKDNLLITDNSTNPIEMFNSRNVNLYEDIVPANSSKLVRIPINSSDGEVYIPQQYLNNCVVNECITTVVKNRVVGDIKKRPVVSKPFETHTRISIQVSQSNLREDVINAIKEFVNPKVKTGLLINPTLSMYDIIPIIQDTFRNSAMNLLLTKVELENVKEYLRQQEIISHYHDGKTNHRGINECYLALSRKYYWPKMKDQITKFINECTICGQAKYDRAPIKQQFSIVPPPKKPFEIVHMDLFTAQSEKYLTFIDVFSKYGQAYLLRDGTAISVLQGLLQFCTHHGLPLTIVTDNGTEFTNQLFSEFIRLHKINHHKTLAHTPNDNGNVERFHSTLLEHLRILRLQHKNEPVINLMPYAILAYNSSVHSFTKCRPFDIITGHFDPRDPLDIDITAHLLQQYMESHKAQMTTVYELINETSLANRTSLIENRNKNREPEATYQPNQQVFIKNPIAARQKTAPRILLNLLTRHLTTAHEIKLETLENGPGLLPFKLGQTRLVSHYHSFLQYIELADHQLTFIPPYPFIATNKKAFMYIEAECPKYNRYYLCEENINHQPRDDPDCIHDLIYNQAMNTSCQPTSVSFTKEAMEQLDDKHYVLIFPETTKIELHCQRLEYSTLQGSYLVTIPQNCKLRTGRLTLANNNDQINGQPLKITEIPKDAKITGPIRPHIKLTSLNLEKIHQIQDDIIQQHPVDLEQSDVTNQALFHTTIPFYGALCGAIVLAVVIAVHRHKSCNITLEKKPREETSKFHPYESPEEPQKKDRIPATFALKIIK

Summary

Uniprot
ProteinModelPortal
PDB
3S3O     E-value=1.13174e-07,     Score=139

Ontologies

Topology

Length:
1130
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.04155
Exp number, first 60 AAs:
0.00073
Total prob of N-in:
0.00062
outside
1  -  1061
TMhelix
1062  -  1084
inside
1085  -  1130
 
 

Population Genetic Test Statistics

Pi
35.162872
Theta
159.518012
Tajima's D
-1.179552
CLR
0
CSRT
0.110894455277236
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号